Biology Test 9-11

108 terms by shrmoss

Create a new folder

Advertisement Upgrade to remove ads

Two true-breeding plants are cross-fertalized. Their offspring are then cross-fertalized. What is the name given to this last offspring generation?

F2 generation

DdEe pea plants can produce ___ type(s) of gametes, but a ddee plant can produce ___ type(s) of gametes.

four...one

In a test cross, F2 refers to ____

the second fillial generation, or the "grandchildren" of the original mating pair

An insect that has the genotype EeGGcc will have the same phenotype as an insect with the genotype ___.

EEGgcc

Mendel's priniciple of independent assortment applies to the ___.

independent assortment of alleles of one gene relative to the alleles of any other gene

Hypercholesterolemia is a disorder in which blood cholesterol levels are elevated. The H allele is incompletely dominate to the h allele, with hh homozygotes haveing extremely high levels of blood cholesterol. A husband and wife are both Hh heterozygotes. What is the chance that their first child will have normal levels of blood cholesterol?

1/4

Snapdragons show incomplete dominance in their flowers. A pink snapdragon is crossed with a red snapdragon. What color(s) are the offspring?

50% red, 50% pink

Which of the following line or lines of evidence support(s) the chromosome theory of inheritatnce?

Genes segregate; chromosomes come in pairs

Three characteristicts assort independently in one species of insect: Red eyes (R) are dominant to black eyes (r). Blue wings (B) are dominant to white wing (b). Green bodies (G) are dominant to yellow bodies (g). A cross is made between two heterozygous insects (RrBbGg). what is the probability that the offspring will be homozygous dominat for all 3 characteristict?

1/64

After crossing a true-breeding red-flowered snapdragon with a true-breeding white-flowered one, you note that all of your F1 population are pink. This is because ____

red and white show incomplete dominance

Two parents of mixed ethnicity have twins, one of which is born white and one of which is born black. This is because of ___

the polygenic nature of skin color genes

Linked genes are inherited together. This is becuase linked genes ____

are on the same chromosome

The fequencey at which crossing over occurs between 2 linked genes depends on ___

how far apart the genes are on the chromosome

When applie to Mendel's experiements, the term true-breeding means a self-fertalization of 2 plants that produces ___

offspring identical to the parent

A child with cystic fibrosis can be born to 2 parents who do not have the disease. This is because the disease ____

is caused by a recessive allele

If a homozygous dominant (AA) is crossed with a homozygouse recessive (aa) for a given character, the offspring will be ___

all of the dominate phenotype

When you cross 2 heterozygotes (Aa), the F1 generation will be ____

in the ration 1:1 homozygotes to heterozygotes

What is an allele

an alternative version of a gene

It is far more common to find human genetic disease caused by ___ alleles then by ___ alleles because ____

recessive...dominant....harmful recessive alleles can survive in the heterozygote without causing any adverse effects on the phenotype

Fetal cells may be removed along with fluid from the womb by a process known as ___

amniocentesis

A red bull is crossed with a white cow and all of the offspring are roan, a shade between red and white. This is an example of genes that are ___

incompletely dominant

A man who has type B blood and a woman who has type A blood could have children of which of the following phenotypes

A,B,AB, or O

A single allele that controls more than one character is said to be ___

pleiotropic

If two genes are linked, ____

the are on the same chromosome

If hair color, eye color, and the presence or absence of freckles were consistently inherited together, the best explanation would be that ____

the genes for these characers are linked on the same chromosome

The Y chromosomes of mammals contain genes that code for ___

"maleness" and a few other characteristics

During DNA replication, ____

each parental strand serves as a template for the syntheses of a complementary strand

How does RNA polymerse know where to start transcribing a gene in mRNA

It starts at a certain nucleotide sequence called a promoter

After an RNA molecule is transcribed from a eukaryotic gene, portions called ___ are removed and the remaining ___ are spliced together to produce an mRNA molecule with a continuous coding sequence

introns...exons

In the lysogenic cycle, new viral particles are ____

packaged and released when triggered by radiation, chemicals, or other environmental signals

Before and RNA virus is assembled and elaves the cell, a number of processes occur. Place these steps into the order in which the occur:

2,3,1

Which of the following is found in RNA but not in DNA

an additional hydroxyl group

During replication, the original "parent" DNA ___

serves as the template for the creation of 2 complete sets of DNA

Prokaryotic organisms have a single origin of replication, whereas eukaryotic organisms have many orgins where replication occurs simultaneously. Which of the following is the most probable reason for this observation

Prokaryotic DNA is much smaller than eukaryotic DNA

Consider the following sequence and explain what effect the mutation has on the protein that is translated:
UCUAUGUUUUCACAGAGGGAAACCCUAACCC(wild type)
UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant type)

prematurely stops the translation of the protein

In transcription, ____

RNA polymerase links nucleotides to form mRNA

In eukaryotic cells, a terminator in mRNA sytheses is ____

a specific nucleotide sequence in DNA that signals the RNA polymerase to stop

In eukaryotic cells, the RNA is processed before it leaves the nucleus. This processing ____

includes the addition of a cap and tail, which protect the mRNA molecule from enzymatic attack, and the removal of introns

An anticodon is ____

a set of triplet bases that is complementary to a codon triplet on mRNA

At the start of translation, where does the initiator tRNA bind

start codon on the mRna molecule

The translation process in eukartyotes requires all of the following: ____

transfer RNA, ribosomes, AUG codons

The type of mutations represented below is a(n) ___
The big red fly had one eye (wild type)
The fbl gre dfl yha don eey (mutant)

shift in reading frame

Emerging viruses can originate from ____

a virus spreading from one host species to another

A micobiologist found that a colony of bacterial clones infected by a phage had developed the ability to make a particular amino acid that the bacteria could not make before the infection. This new ability was probably a result of ____

transduction

Conjugations is a very effective process for sperading antibiotic resistance. Which statement best explains this observation

2 different strains of bacteria can transfer DNA during conjugation

The four bases contained in DNA are ____

adenine, guanine, cytosine, thymine

Which of the following describes a complete nucleotide

a nitrogenous base, a sugar, and a phosphate group

Which of the folloing is only associated with RNA

uracil

The 2 strands of a DNA molecule are joined to each other through ___

hydrogen bonds between nucleotide bases

Which of the following accurately reflects complementary base pairing in the DNA molecule

Guanine froms 3 hydrogen bonds with cytosine

Which of the following statements is true about double-stranded DNA

the strands run in opposite directions

2 new strands of DNA molecules grow as bases are added by the enzyme ____

DNA polymerase

What enzyme joins DNA fragments

DNA ligase

A gene is usually ____

the information for making a polypeptide

When messenger RNA (mRNA) is being transcribed, the RNA base ____ always pairs with the base ___ in DNA

U....A

Which of the following is NOT true about the genetic code

The genetic code is ambiguous

Which of the following statements about the genetic code is correct

Each amino acid in a polypeptide is coded for by 3 bases in the DNA

There are 6 different codones that code for the amino acid leucine in a protein. Because of this, we say that the code is ____

redundant

A promoter is a specific binding site for ____

the enzyme RNA polymerase

In order for transcription to occur in a strand of a DNA molecule, there would have to be a specific recognition sequence, called a(n) ____, upsteram of the DNA sequence

promoter

What is the proper order of the following events in the expression of a eukaryotic gene

transcription, RNA processing, translation

A base-substitution mutation in a germ cell line is likely to have no effect of phenotype is substitution ___

occurs in an intron

In a eukaryotic cell, transcription takes place ____

in the nucleus

The function of tRNA during protein syntheses is to ____

deliver amino acids to their proper site during protein synthesis

During translation in a eukaryotic cell, ___

polypeptides are synthesized at ribosomes, according to instructions carried by mRNA

During the process of translation, ___ matches an mRNA codon witht the proper amino acid

Transfer RNA

Which brief outline of protein syntheses is correct

Messenger RNA is made on a DNA template, and then amino-acid bearing tRNAs line up on it through codon-anticodon pairing

Ultraviolent (UV) radiation is damaging because it ___

causes mutations in DNA

Genetic mutations ____

can occur naturally

The phage reproductive cycle that kills the bacterial host cell is known as a ___cycle

lytic

A prophage is a(n) ____

viral genetic material that has been incorporated into a bacterial cell's chromosome

In the lytic life cycle of phages, ____

the nucleic acid of the phage is all that enters the host cell

Viroids are ___ molecules and are found in ____

small circular RNA...potatoes and other vegtables

F plasmids ____

contain the genes necessary to make a sex pilus

Which of the following molecules would bind to an operator

an active repressor

To function as specialized cellsm your muscle and bone cells undergo significant changes in gene regulation. This is because ____

different genes are switched on and off in each type of cell

In fruit flies, there are molecules in the egg that determine the future head and tail ends of the animal. What occurs when mRNA from the head end of an embryo is injected into the taile end of an early embryo

some head structures develp at the tail end; the head end develops normally

Since the first cloned animal was produced using a fully differentiated cellm a number of observation have been made, Which of the following statements is true in regard to reproductive cloning

Only a small fraction of cloned embryos develp normally

Stem cells could be immensely important in the treatment of which of the following conditions

spinal cord injuries

A proto-oncogene is a norma gene that can change into an oncogene. Oncogenes are potentially lethal genes that can cause cancer. Why do cells continue to maintain proto-oncogenes

Proto-oncogenes are necessary for normal control of cell division

Lac operon regulatory genes are ___

continually expressed

What controls the way in which a zygote differentiates

Selective genes are turned on and off, depending on the fate of the cell

When are DNA molecules the least tightly coiled

S-phase of interphase

In eukaryotic cells, several proteins are involved in the process of transcription. This process involves enhancers that are ____

bound by activators, causing DNA to bend

Alternative RNA splicing has revealed inaccuracies in the one gene-one polypeptide hypothesis. Why

Transcription of the same gene can lead to the production of different mRNAs

MicroRNA (miRNA) controls ____

translation

After translation is complete, the insulin ____

the cutting of the initial translation product to yield 2 shorter chains joined together by sulful linkages

Proto-oncogenes have the potential to become oncogenes. Which of the following is most likely to lead to cancer

a mutation that causes the proto-oncogene to become overative

In humans, the most common cancer is ____

lung cancer

In prokaryotes, a group of genes with related functions is called ___

an operon

The promoter of an operon ____

is where RNA polymerase binds

In prokaryotes, operones ____

regulate the rate of transcription

In E. coli the lactose operon (lac operon) is turned on in the presence of ____

lactose

In some species of bacteria that are resistant to the antibiotic tetracycline, the antibiotic molecule attaches to a repressor protie, This prevents binding of the represson to the bacterial DNA and allows a set of genes to be transcribed. The transcription of these genes is under the control of a(n) ____

operon

Operons ____

function in frequently changing environments

Cells become specialized by a process known as ____

differentiation

In eukaryotes, chromosomes are tightly coiled due to the association of histone proteins and DNA. These structures are known as ____

nucleosomes

Histones are ____

proteins around which DNA is coiled

Enhancers are ____

specific DNA sequences located distant to the promoter

Eukaryotes have that ability to switch gene expression on or off. If a repressor protein bind to a DNA sequence called a(n) ____, it may block gene expression

silencer

In eukaryotes, gene expression is regulated mostly by ____

controlling the transcription of genes

Which of the following is true of gene regulations in both eukaryotes and prokaryotes

Transcription is the typical point at which gene expression is regulated

MicroRNA (miRNA) functions by binding to ___ and blocking translation

complementary mRNA sequences

Clones are derived ____

from a single ancestor cell

Embryonic stem cells differ from adult step cells because they ____

can differentiate into all cell types

Which of the following statements best describes cance cells

Normal controls over cell division have benn altered

In human cells, oncogenes ____

stimulate cell division

Which other following genes inhibits cell division

tumor-suppressor genes

Please allow access to your computer’s microphone to use Voice Recording.

Having trouble? Click here for help.

We can’t access your microphone!

Click the icon above to update your browser permissions above and try again

Example:

Reload the page to try again!

Reload

Press Cmd-0 to reset your zoom

Press Ctrl-0 to reset your zoom

It looks like your browser might be zoomed in or out. Your browser needs to be zoomed to a normal size to record audio.

Please upgrade Flash or install Chrome
to use Voice Recording.

For more help, see our troubleshooting page.

Your microphone is muted

For help fixing this issue, see this FAQ.

Star this term

You can study starred terms together

NEW! Voice Recording

Create Set