Bioethics Genetic Engineering Review
About this set
Created by:
keilert4817 on May 6, 2012
Subjects:
Log in to favorite or report as inappropriate.
Order by
40 terms
Terms | Definitions |
|---|---|
T/F: The fact that human genes inserted into bacteria produce proteins shows that the basic mechanisms of gene expression are different in bacteria and humans. (Change if false) | false, the same |
T/F: To produce a recombinant plasmid, the plasmid and the foreign DNA are cut with a different restriction enzyme. | false, the same |
T/F: Scientists use genetic markers to determine which cells have been successfully transformed. | true |
T/F: Bacterial cells that have been transformed with a plasmid that carries a genetic marker for resistance to the antibiotic tetracyline will not survive in a culture treated with tetracyline. | false, will survive |
The process of making changes in the DNA code of living organisms is called _____ | genetic engineering |
Round up ready crops contain _____ | a gene for round up resistance |
What kind of techniques do scientists use to make transgenic organisms? | genetic engineering |
A DNA molecule produced by combining DNA from different sources is known as ____ | recombinant DNA |
What could be seen as a possible eugenics movement? | germline genetic engineering |
During transformation.... | a bacterium takes in a plasmid |
Which of the following includes all the others?-plasmid -transformed bacterium -foreign gene -recombinant DNA | transformed bacterium |
What is an advantage of using transgenic bacteria to produce human proteins? | transgenic bacteria can produce human proteins in large amounts |
a gene that makes it possible to distinguish bacteria that carry a plasmid containing foreign DNA from those that don't is called a(n) ____ | genetic marker |
| Suppose a bacterial culture were mixed with recombinant plasmids containing a gene for resistance to penicillin. The bacterial culture was then treated with penicillin. Which of the following statements is NOT true? -Those bacteria that contain the plasmid will survive. -The penicillin will kill the bacteria that were transformed. -The gene for antibiotic resistance is expressed in the bacteria that survive. -Those bacteria that are successfully transformed will survive. | The penicillin will kill the bacteria that were transformed |
(See 13.1) What does figure 13.1 show? | a restriction enzyme producing a DNA fragment |
(See 13.1) What are structures C and D called? | sticky ends |
(See 13.1) Between which nucleotides is the DNA cut? | adenine and guanine |
(See 13.1) Why are structures C and D important? | they allow two pieces of DNA to be joined together (spliced) |
A recombinant plasmid gets inside a bacterial cell by ____ | transformation |
Why does the human insulin gene produce the same protein in humans and in transgenic bacteria? | all organisms use genes in the same way, gene expression is the same in all organisms, the same insulin gene is found in both humans and transgenic bacteria |
What is often used as a genetic marker in plasmids? | gene for antibiotic resistance |
Plasmids are naturally found in some ___ | bacteria |
A transgenic organism that has extra copies of a gene produces more of the _____ that is coded for by that gene | protein |
Why do transgenic bacteria that have the gene for human insulin produce insulin in great abundance? | bacteria reproduce to create many offspring that will also produce insulin |
(See 13.3) During which numbered step is transformation occuring? | 4 |
(See 13.3) During which numbered step are bacteria reproducing? | 5 |
(See 13.3) During which numbered step(s) is a restriction enzyme being used? | 1 and 2 |
(see 13.3) Which numbered step produces a recombinant plasmid? | 3 |
Bt crops contain a gene from ____ | a type of bacteria |
Bt crops have an additional gene that allows them to ____ | produce a natural insecticide |
Transgenic animals are animals that ____ | contain genes from a foreign species, have recombinant DNA, are genetically engineered |
Many ethicists argue that germline genetic modifications may be more ethically problematic than other forms of genetic modification because: | the effects are multigenerational, it could alter human evolution |
Transgenic goats have been produced that have the ability to produce ____ | spider silk |
Which of the following is a GMO?-transgenic plant -goat that produces human proteins -cow with recombinant DNA | all of the above |
What is most commonly used as a vector in gene therapy? | virus |
Attempts to correct genetic defects in the sperm, egg, or a very early embryo would be classified as ____ | germline gene therapy (or germline engineering) |
The introduction of healthy, therapeutic genes in attempts to correct a genetic disease or disorder is ______ | gene therapy |
A SCIDs patient has recently made a decision to participate in a cinical research trial in which he will receive a therapeutic gene in attempts to regain immune function. This is an example of ______ | somatic cell gene therapy |
How many pieces of DNA will be produced if the following DNA is digested with the restriction enzyme EcoRI? What kind of ends are produced?EcoRI --- 5' G - AATTC 3' top row[5'ACGACGTATTAGAATTCTTATCCGCCGCCGGAATTCTCATCA] bottom row [3'TGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT] | 3, sticky ends |
| Put the steps of the process of using transgenic bacteria to use human insulin in the correct order. a. DNA ligase seals sticky ends (seals sugar-phosphate backbone of recombinant plasmid) b. restriction enzyme is used to cut out the human insulin gene and to cut open plasmid c. sticky ends are attracted to one another, nitrogen bases of sticky ends form H bonds d. isolate the insulin e. asexual reproduction f. transformation occurs | b, c, a, f, e, d |
First Time Here?
Welcome to Quizlet, a fun, free place to study. Try these flashcards, find others to study, or make your own.