| Term | Definition |
|---|
| genes | made of nucleic acids (DNA) |
| change in DNA sequence | leads to a different protein being made |
| DNA | controls production of proteins in a cell |
| 3 | number of letters in a codon |
| proteins | made of amino acids |
| ATAATACGG | other half of this DNA strand: TATTAGCC |
| A | matches with nitrogen base T |
| G | matches with nitrogen base C |
| A, C, G, T | nitrogen bases found in DNA |
| A, C, G, U | nitrogen bases found in RNA |
| nucleotide | phosphate, sugar and nitrogen base |
| sugar found in DNA | deoxyribose |
| sugar found in RNA | ribose |
| leads to RNA | DNA |
| leads to a protein | RNA |
| 3 nucleotides | code for one amino acid |
| T | There are no _____ in RNA. |
| U | There are ____ in RNA. |
| transcription | making mRNA from DNA's pattern |
| translation | making proteins (amino acid chains) from mRNA's pattern |
| chromosome | contains many genes |
| amino acids | glutamine, valine, leucine, methionine |
| mRNA | found in nucleus with DNA |
| tRNA | found only at ribosome (cytoplasm) |
| DNA, protein, cell | ____ gives instructions for making ___ in a _____. |
| UACCCUA | mRNA made by this DNA strand: ATGGGAT |
| AACUGGACC | will code for 3 amino acids |
| UAUAUA | will code for 2 amino acids |
| CCG | will code for 1 amino acid |
| ATTCGATTTCCGTATAGCCCGACC | large DNA nucleotides |
| AUCGUUACUAAACCGAUAACGGC | large RNA nucleotides |
| nucleus | where transcription occurs |
| ribosome in cytoplasm | where translation occurs |
| replication | copying DNA in the nucleus |
Combine with other sets
Share on Facebook
Share on MySpace