Advertisement Upgrade to remove ads

Evolution

Changes in the DNA sequence from one generation to the next may result in offspring that are altere4d in fitness compared with their parents. The process of change and selection over the course of many generations is the basis of?

Nucleus

Although there are many distinct prokaryotic species, most have a small range of shapes, sizes and growth rates. Which of the following characteristics are not observed in prokaryotes?

Some bacteria can live by consuming exclusively inorganic substances

Regarding prokaryotes, which of the statemnts below is true? a)Oxygen is toxic to prokaryotic organisms. b)Mitochondria may have evolved from anaerobic bacteria c)Some bacteria can live by consuming exclusively inorganic substances d) When food sources become scarce, prokaryotes will tend to die off.

Nuclear Envelope

The _________ __________, is made up of two concentric membranes with themembrane of the endoplasmic reticulum

Chromosome

The Nucleus, an organelle found in eukaryotic cells, confines the _____, keeping them separated from other components of the cell.

Endosymbionts

Mitochondria contain their own genome, are able to duplicate, and actually divide on a different timeline from the rest of the cell. Nevertheless, mitochondria cannot function for long when isolated from the cell because they are?

all of the above

Biologists cannot possibly study all living species. Instead, they try to understand cell behavior by studying a select subset of them. Which of the following characteristics are useful in an organism chosen for use as a model in the laboratory studies? a) Amenability to genetic manipulations b) ability to grow under controlled conditions c) rapid rate of reproduction d) all of the above

Cell motility

Brewer's Yeast, apart from being an irreplaceable asset in the brewery and in the bakery, is an experimental organism used to study eukaryotic cells. However, it does face some limitations. Which of the processes below cannot be studied with yeast?

Transfer of electrons from one atom to another

An ionic bond between two atoms is formed as a result of?

Phosphoryl

What type of chemical group is circled on the nucleotide shown below? (P=O3)

Ampipathic

Cholesterol is an essential component of biological membranes. Although it is much smaller than the typical phospholipids and glycolipids in the membrane, it is a(n) ________ molecule, having both hydrophilic and hydrophobic regions

A disaccharide consist of a sugar covalently linked to another sugar molecule or other molecules such as an amino acid or nucleotide.

Which one of the following statements is FALSE: a)A disaccharide consist of a sugar covalently linked to another sugar molecule or other molecules such as an amino acid or nucleotide. b)The hydroxyl groups on monosaccharides are reaction hotspots and can be replaced by other functional groups to produce derivatives of the original sugar. c)Double bonds in the hydrocarbon tail of a fatty acid greatly influence its structure. d) Glycerol is a three-carbon compound that connects the fatty acid tails with the polar head group in phospholipids.

1,2,5

Which of the following statements about amino acids is TRUE? 1.Twenty amino acids are commonly found in proteins. 2. Most of the amino acids used in protein biosynthesis have uncharged side chains. 3. Most of the amino acids used in protein biosynthesis have charged side chains 4. Amino acids are often linked together to form branched polymers 5. All amino acids contain an NH2 and a COOH group linked to an a(alpha) carbon 6. All amino acids contain an NH2 and a COOH group linked to a b(beta) carbon

Hydrogen Bonds

Both DNA ane RNA are synthesized by covalently linking a nucleotide triphosphate to the previous nucloetide, constantly adding to a growing chain. In the case of DNA, the new strand becomes part of a stable helix. The two strands are complementary in sequnce and anti-parallel in directionality. What is the prinicpal force that holds these two strands together?

thatonething

Which of the following is NOT considered a "special purpose" protein? a) antifreeze molecule b) antibodies c) Elastic Fibers d) Hormones e) thatonething

Polar, Hydrophilic, Tyrosine

Which of the following characteristics concerning amino acids is correct? a) Polar, Hydrophobic, Tryptophan b)Polar, Hydrophilic, Tryptophan c) Polar, Hydrophilic, Tyrosine d) Nonpolar, hydrophilic, tryptophan e)Nonpolar, Hydrophobic, Tryosine

The polypeptide backbone is free to rotate about each peptide bond.

Which of the following statements are TRUE? a)Peptide bonds are the only covalent bonds that can link together two amino acids in proteins. b) Non-polar amino acids tend to be found in the interior of proteins c) The polypeptide backbone is free to rotate about each peptide bond. d) The sequence of the atoms in the polypeptide backbone varies between different proteins

They form protein aggregates

The polypeptide backbone is free to rotate about each peptide bond.

Huntington's disease

Prion diseases are diseases when misfolded proteins can cause properly folded proteins to fold into abnormal conformations in the brain. Which of the following diseases is NOT classified as a prion disease? a) creutzfeldt-jacob disease b) "madcow" disease c) Bovine Spongiform encephalopathy, d) huntington's disease e) Scrapie

Hydrogen bonds along the protein backbone

Although all protein structures are unique, there are common structural building blocks that are referred to as regular secondary structures. Some have (alpha) a-helices, some have (beta) b-helices, and still others have a combination of both. What makes it possible for proteins to have these common structural elements?

amine, carbonyl

In the (alpha) a-helix the hydrogen bonds occur mainly between ________ hydrogen and _________ groups of the backbone

Coiled-coil patterns

Which of the following is NOT a feature commonly observed in (beta) b-sheets? a)Antiparallel regions b)Coiled-coil patterns c)Extended polypeptide backbone d)Parallel regions

A protein segment that folds independently

Protein structures have several different levels of organization. The primary structure of a protein is its amino acid sequence. The secondary and tertiary structures are more complicated. Which of the definitions below best fits the term "protein domain"

Tertiary Structure

Which of the following describes the overall three-dimensional folding properties of a polypeptide?

Molecular Chaperones

Protein families that have evolved with the function of helping unfolded or misfolded proteins achieve proper three dimensional conformation are called?

A and C

Enzymes work by _________ a)Binding substrates with stereoselectivity and to increase their local concentration b)Harvesting energy from the environment to yield higher energy, and hence more reactive, reactants c)Inducing bond strain and binding more tightly to the transition state than to either reactants or products.

cytoplasm, mitochondria, cytoplasm

Glycolysis occurs in the __________; the TCA cycle occurs in the _________ of eukaryotes and the _________ of bacteria

substrate-level phosphorylation

The formation of ATP by the transfer of Pi from a metabolic intermediate to ADP is called?

catabolic

Chemical reactions carried out by living systems depend on the ability of some organisms to capture and use atoms from nonliving sources in the environment. The specific subset of these reactions that breakdown nutrients in food can be described as?

CO2, H2O

During respiration, energy is retrieved from the high-energy bonds found in certain organic molecules. Which of the following, in addition to energy, are the ultimate products of respiration?

ADP to ATP (7.3)

Change in G indicates the change in the standard free energy as a reactant is converted to product. Given what you know about these values, which reaction belwo is the least favorable? HINT: the highest number is the least favorable

Ethanol

In what molecules is most of the energy of glucose stored at the end of fermentation by yeast?

The change in G for the oxidation of the aldehyde group on G3-P to form a carboxylic acid is more negative than the change for G for ATP hydrolysis

The first energy generating steps in glycolysis begin when glyceraldehyde 3-phosphate (G3-P) undergoes an energetically favorabel reaction in which it is simultaneously oxidized and phosphorylated by the enzyme G3-P dehydrogenase to form 1,3 bisphopsphoglycerate (1,3-BPG), with the accompanying conversion of NAD+ to NADH. In a second energetically favorable reaction catalyzed by a second enzyme, the 1,3-BPG is then converted to 3-phosphoglycerate, with the accompanying conversion of ADP to ATP. Which of the following statements is true? a)The reaction G3-P --> 1,3-BPG should be inhibited when levles of NADH Fall b)The change in G for the oxidation of the aldehyde group on G3-P to form a carboxylic acis is more negative than the change for G for ATP hydrolysis c) The high-energy bond to the phosphate group in G3-P contributes to driving the reaction forward d)The cysteine side chain on the enzyme is oxidixed by NAD+

Oxaloacetate

Pryuvate is an important metabolic intermediate that can be converted into several other compounds, depending on which enzyme is catalyzing the reaction. Which of the following cannot be produced from pyruvate in a single enzyme-catalyzed reaction?

Oxaloacetic acid cycle

The reaction cycle that uses acetyl CoA to generate electron carrier molecules needed in the electron transport chain is important for powering the cell. Which of the names below is not one of those commonly used to describe this reaction cycle? a) tricarboxylic acid cycle b) krebs cycle c) oxaloacetic acid cycle d) citric acid cycle

NADH

In the final step of the citric acid cycle, oxalacetate is regenerated through oxidation of malate and coupled with the production of what other molecule?

Chemiosmotic Coupling

The term used when bond-forming reactions and membrane transport processes in the mitochondrial membrane is?

ATP, allosterically; AMP, allosterically

The enzyme phosphofructokinase (PFK) uses ATP to convert fructose 6-phosphate to fructose 1,6-bisphosphate. Which of teh following most accurately describes the regulation of this enzyme? High _____ levels _________ inhibit it, while high _________ levels _________ activate it

Amino acids

When organisms undergo changes in circumstances (increase muscle activity, low O2 availability, decrease in carbohydrate intake) they must rely on their fuel reserves. The pathways to utilize stored fuels reserve or make "new" glucose are regulated by key enyzmes and other molecules. of the following molecules, pathways, or enzymes, which CANNOT be used to replenish or mobilisze these fuels in ANIMALS?

Liver

Which organ is principally responsible for supplying glucose to the rest of the body when glucose reserves are low?

ATP, anaerobic

In humans, glycogen is a more useful food storage molecule than fat because it can be utilized to produce _______ under ____________ conditions whereas fat cannot

O2 is reduced to H2O

Stage 1 of oxidative phosphorylation requres the movement of electrons along the electron-transport chain coupled to the pumping of protons into the intermembrane space. What is the final result of these electron transfers?

Thylakoid space

In stage 1 of photosynthesis, a proton gradient is gerenated and ATP is synthesized. Where do protons become concentrated in the chloroplast?

low; H2O

In the electron-transport chain in chloroplasts, _____ -energy electrons are taken from ______

NADPH

Stage 2 of photosynthesis, sometimes referred to as the dark reactions, involves the reduction of CO2 to produce organic compounds such as sucrose. What cofactor is the electron donor for carbon fixation?

The antenna complex

The photosystems in chloroplasts contain hundreds of chorlophyll molecules, most of which are part of _________

Griffith

Several experiments were required to demonstrate how traints are inherited. Which scientist or team of scientists first demonstrated that cells contain some component that can be transferred to a new population of cells and permanently cause changes in new cells?

1.7; left handed

Nucleosomes are formed when DNA wraps __________ times around the histone octamer in a ___________ coil

ATP Hydrolysis

Although the chromatin structure of interphase and mitotic chromosomes is very compact, DNA-binding proteins and protein complexes must be able to gain access to the DNA molecule. Chormatin-remodeling compexes provide this access by using the energy of ____ _____________ to move nuclosomes

The polarity of a DNA strand results from the polarity of the nucleotide subunits

Which of the following statements is false? a)DNA molecules, like proteins, consist of a single, long polymeric chain that is assembled from small monomeric subunits b)The polarity of a DNA strand results from the polarity of the nucleotide subunits c)There are five different nucleotides that become incorporated into a DNA strand d)Hydrogen bonds between each nucleotide hold individual DNA strands together

Daughter DNA = 1 parent strand and 1 new strand

DNA replication is considered semiconservative because _________

nucleotides are being added to the 3'-OH end of the growing strand

Which of the following regarding DNA replication is TRUE? a) Nucleotides are being added to the 5' OH end of the growing strand b) Nucleotides are being added to teh 3'-phosphate end of the growing strand c) DNA polymerase can add nucleotides to the 5'-phosphate end of the growing strand d) nucleotides are being added to the 3'-OH end of the growing strand e) both ends can have nucleotides added, so both ends are growing at the same rate

hydrolysis of PPi to Pi+Pi

DNA polymerase catalyzes the joining of a nucleotide to a growing DNA strand. What prevents nucleotides from being released from the growing end of a newly synthesizing strand?

Telomerase is a DNA polymerase that carries its own RNA molecule to use as a primer at the end of the lagging strand

Which of the following statements regarding DNA replication are TRUE? a) primase is only needed to initiate DNA replication on the lagging strand b) The sliding clamp is loaded multiple timeson each DNA strand c) Telomerase is a DNA polymerase that carries its own RNA molecule to use as a primer at the end of the lagging strand d) primase requires a proofreading function that ensure there are no errors in the RNA primers used for DNA replication

Initiator Proteins

A molecule of bacterial DNA introduced into a yeast cell is imported into the nucleus but fails to replicate the yeast DNA. Where do you think the block to replication arises? Which protein or protein complex is responsible for the failure to replicate bacterial DNA?

5, 6, 2, 3, 4, 1

List the correct sequence for homologous recombination: 1. Holliday junction cut and ligated 2. Strand Invasion 3. DNA synthesis 4. DNA ligation 5. Double-strand break 6. Nucleases create uneven strand

Sliding Clamp

DNA polymerases are processive, which means that they remain tightly associated with the template strand while moving rapidly and adding nucloetides to the growing daughter strand. Which piece of the replication machinery accounts for this characteristic?

Template: 3-5 Copy: 5-3 (D)

Choose correct diagram for directionality of DNA strands at one side of the replication fork

The leading strand doubles back on itself to form a primer for the lagging strand

Telomeres serve as caps at the ends of linear chromosomes. Which of the following is NOT true regarding the replication of telomeric sequences? a) The lagging strand telomeres are not completely replicated by DNA polymerase b) Telomeres are made of repeating sequences c) Additional repeated sequences are added to the template strand d) The leading strand doubles back on itself to form a primer for the lagging strand

Base pair change

Sickle-cell anemia is an inherited disease. Individuals with this disorder have misshapen (sickle shaped) red blood cells caused by a change in the sequence of the beta-globin gene. What is the nature of the change?

A nick in the new strand

Beside the distortion in the DNA backbone caused by a mismated base pair, what additional mark is there on eukaryotic DNA to indicate which strands need to be repaired?

TTAT

What happens to TCAT if it is DEANIMATED and not repaired? What point mutation would you observe? TCAT --> C turns to A

TCT

What happens to TCAT if it is depurinated? Loses A

Thymidine dimers are covalent between thymidines on opposite DNA strands

Which of the following statements is NOT an accurate statement about thymidine dimers? a) Thymidine dimers can cause the DNA replication machinery to stall b) Thymidine dimers are covalent between thymidines on opposite DNA strands c) prolonged exposure to sunlight causes thymidine dimers to form d) repair proteins recognize thymidine dimers as distortion in the DNA backbone

Meiosis

In additon to the repair of DNA double-strand breaks, homologous recombination is a mechanism for generating genetic diversity by swapping segmetns of parental chromosomes. During which process does swapping occur?

Unlike DNA, RNA uses a uracil base and a deoxyribose sugar

Which of the following statements are false? a) Unlike DNA, RNA uses a uracil base and a deoxyribose sugar b) A new RNA molecule can begin to be synthesized from a gene before the previous RNA molecule's synthesis is completed c) If two genes are to be expressed in a cell, these two genes can be transcribed with different efficiencies d) RNA polymerase is responisble for both unwinding the DNA helix and catalyzing the formation of the phosphodiester bonds between nucleotides

far from the promoter

What is the main reason that a typical eukaryotic gene is able to respond to a far greater variety of regulatory signals than a typical prokaryotic gene or operon? The transcription of a eukaryotic gene can be influenced by proteins that bind

AUAGGCAUUCGAUCCGGAUAGCAU

TATCCGTAAGCTAGGCCTATCGTA what would the copy be

recognizes promoter sites in the DNA

The sigma subunit of bacterial RNA polymerase__________?

Antibiotics

Inhibits protein synthesis

5 to 3

Transcription is similar to DNA replication in that nucloetide polymerization occurs only in the __________ direction

Primase can initiate RNA synthesis without the need for a base-paired primer

There are several reasons why the primase used to make the RNA primer for DNA replication is not suitable for gene transcription. Which of the statements bleow is NOT one of those reasons? a) Primase initiates RNA synthesis on a single stranded DNA template b) Primase can initiate RNA synthesis without the need for a base-paired primer c) primase synthesizes only RNA's of about 5-20 nucleotides in length d) The RNA synthesized by primase remains base-paired to the DNA template

The 5s rRNA (small subunit) is responsible for protein folding and stablizing the RNA core

In a complete ribosome which of the following is FALSE? a) The ribosome is a ribozyme (T) b) The 5s rRNA (small subunit) is responsible for protein folding and stablizing the RNA core (F) c) the 23S rRNA (large subunit) contains a catalytic site for peptide bonds (T) d) the 23S rRNA (large subunit) is responisble for protein folding and stabilizing the RNA core (T)

The ribosome binds to the mRNA

Which of the following does not occur before a eukaryotic mRNA is exported from the nucleus? a) the ribosome binds to the mRNA b) the mRNA is polyadenylated at its 3'end c) 7-methyl-G is added in a 5' to 5' linkage to the mRNA d) RNA polymerase dissosciates

NOT

Splicing of exons is ________ a covalent modifcation that can be made to an RNA molecule in eukaryotic cells before the RNA molecule becomes a mature mRNA

Misfolded proteins are delivered to the proteasome, wher ethey are sequestered from teh cytoplasm and can attempt to refold

Which of the following statements about the proteasome is false? a) Ubiquitin is a small protein that is covalently attached to proteins to mark them for delivery to the proteasome (T) b) Proteases reside in the central cylinder of a proteasome (T) c) misfolded proteins are delivered to the proteasome, where they are sequestered from the cytoplasm and can attempt to refold (F) d) The protein stoppers that surround the central cylinder of the proteasome use energy from ATP hydrolysis to move protesin into the proteasome inner chamber (T)

GUUCCCGUAUAC - AUG(start) - CGU(arginine) - GCCGGGGGC

GUUCCCGUAUACAUGCGUGCCGGGGGC -Which amin acid will be on the tRNA that is the first to bind to the A-site of the ribosomes

AAG - Lysine

GUUCCCGUAUACAUGCGUGCCGGGGGC -Which amino acid would you expect a tRNA with the anticodon 5-CUU-3' to carry

CAC and CAU

what is an example of a wobble

5-CCA-3

anticodon for tRNA after stop codon (CC -GUU - ACC - AGG - CCU - CAU - UAU - UGG(psite) - UAA(stop) - CGG - AAAAAAAAAAAAAAA

rRNA contains the catlytic activity that joins amino acids together

Whcih of the following statemnts is true? Ribosomes are large RNA structures composed solely of rRNA (F), b) Ribhosome are synthesized entirely in the cytoplasm (F) c) rRNA contains the catalytic activity that joins amino acids together (T) d) A ribosome binds one tRNA at a time

Scanning along the mRNA from the 5'end

In eukaryotes, but not in prokaryotes, ribosoems find the start site of transcription by?

Ribosomes must bind to the 5'cap before initiating translation

Whichi fo the following statemnts about prokaryotic mRNA molecules is false? a_ a single prokaryotic mRNA molecule can be translated into several proteins (T) b) Ribosomes must bind ot the 5'cap before initiating translation (F) c) mRNAs are not polyadenylated (T) d) Ribosomes can start translation an mRNA molecule before transcription is complete (T)

True

The embryo that develops from the nuclear transplant experiment is genetically identical to the donor fo the nucleus.

repressor, tryptophan

The tryptophan operator bind to the tryptophan ___________ when the repressor is bound to ______________

The lac represson binds when lactose is present in the cell

Which of the following statemnts about the lac operon is FALSE? a) the Lac repressor binds when lactose is present in the cell (F) b) Even when the Cap activator is bound to DNA, if lactose is not present, the lac operon will not be transcribed (T) c) The CAP activator can only bind DNA when it is bound to cAMP (T) d) the Lac operon only produces RNA when lactose is present and glucose is absent (T)

transcriptional regulators

Combinatorial control of gene expression involves groups of T___________ R__________ working together to determine the expression of a gene

Proper segregation of housekeeping proteins when cells divide

Which of the following is not a general mechanism that cells use to maintain stable patterns of gene expression as cell divide a) proper segregation of housekeeping proteins when cells divide (NOT) b) a positive feedback loop, mediated by a transcriptional regulator that activates transcription of tis own gene in addition to other cell-type specific genes (IS) c) Faithful propagation of condesned chromatin structures as cells divide (IS) d) inheritance of DNA methylation pattersn when cells divide (IS)

False

Immediately after DNA replication , each daughter helix contains one methylated DNA DNA strand, which corresponds to the newly synthesized strand

FALSE

A mutation that arises in a mother's somatic cell often causes a disease in her daughter

C

Graph - Mutation in germ cell will affect daughter

a mutation that changes the subcellular localization of a portein

which of the following changes is Least Likely to arise from a point mutation in a regulatory region of a gene: a) a mutation that changes the time in an organism's life during which a protein is expressed b) a mutation that eliminates the production of a protein in a specific cell type c) a mutation that changes the subcellular localization of a portein d) a mutation that increases the level of protein production in a cell

FALSE

Because Gene duplication can occur when crossover events occur, gees are always duplicated onto homologous chromosomes

RNA Splicing

Which fo the following functions do you NOT expect to find in the set of genes found in all organisms on earth

highly conserved

Genes involved in sugar metabolism is

conjugation

mechanism that results in genetic change that is common in prokaryotes and rare in eukaryotes

True

point mutations at the nucleotide leve are classified as neutral mutations

NOT characteristics of somatic cells

NOT characteristics: Pass genetic information on to other somatic cells in their offspring, pass on genetic information, passing of mutations to other somatic cells is responsible for all human cancers

Evolutionary History of globin gene framily members

The fetal beta globins arose from a gene duplication that occured 200 million years ago, which gave rise to a beta-globin expressed in teh fetus and a beta-globin expressed in the adult

recruit histone deacetylases

What can gene activatorys not do

water molecules form cage like structures around hydrophobic molecules

What makes bilayer formation energetically favorable

True

Membrane Lipids diffuse within the palne of the membrane

shorter tails and more double bonds

Bacterial PM adjustment (warm to cold)

flippases

Which group of enzymes regulate growth fro both halves of the bilayer and selectively retain certain types of lipids on one side or the other

True

Cholesterol does not have a fatty acid tail

endoplasmic reticulum

Where does most new membrane synthesis take place in a eukaryotic cell?

switching between lipid bilayers

membrane lipid movement that is not spontaneous

membrane thickness

Membrane permeability, membrane fluidity, and membrane rigidity are controlled by cholesterol. What does cholesterol not control?

luminal, golgi

New membrane phospholipids are synthesized by enzymes bound to the __________ side of the ____________ membrane

alpha helices

Porin proteins are made primarily of beta sheets, cannot form narrow channels, and have alternating hydrophobic and hydrophilic amino acids. Porins are not made primarily of

cortex

Plasma membranes are extremely thin and fragile, requireing an extensive support network of fibrous proteins. This network is called the_____________

spectrin

principal fibrous protein of the cortex of a red blood cell

FALSE

The arrangement of the oligosaccharide side chains is highly ordered, much like the peptide bonds of a polypeptide chain

FALSE

glycoproteins have long carbohydrate chains

specific binding to solutes

Transporters, in contrast to channels, work by

glucose

Lowest rate of diffusion across a permeable membrane? a) glucose b) water c) glycerol d) water

Active transport

type of transport that harnesses energy provided by other components in the cell to drive the movement of solutes across memebranes and their concentration gradient

NOT

K+ coupled is ____ a common way to perform active transport

Ca2+ pumps in the ER would keep Ca2+ low

What would happen to intracellular Ca2+ if you blocked Ca2+ pumps in the PM.

low levels prevent Ca2+ from altering the activity of molecules in the cytosol

Why are Ca2+ pumps important? Why do we need to keep low levels of Ca2+ in the cytosol?

opens more frequently when stimulated

Describe the behavior of a gated channel

stress-gated

what channels stimulate auditory nerves

FALSE

Proteins to be delievered to the ER lumen are synthesized on smooth ER

TRUE

In a typical cell, the area of the endoplasmic reticulum membrane far excces the area of plasma membrane

Mitochondria

Which of the following organelles are not part of the endomembrane system

True

Chaperone proteins in the mitochondria facilitate the movement of proteins across the outer end and inner mitochondrial membranes

synthesized

Most proteins destined to enter the ER begin to cross the membrane while still being _________

cytosol

Where would you expect to find ribosomes translating mRNAs that encode ribosomal proteins

glycosylation and disulfide bond formation

Two protein modifications that occur in the ER but not in the cytosol

extracellular space

Removal of the ER retention signal puts it on the default pathway which will take it to the

ER - Golgi - Plasma membrane

Pathway for protein destined for plasma membrane

FALSE

Clathrin Molecules are important for binding to and selecting cargos for transport

Adaptins

Not involved in directing transport vesicles to the target membrane

one type of membrane

An individual transport vesicle will fuse with only

paractyosis

NOT a fate for an endocytosed molecule that has reached the endosome

FALSE

Dissolved gases such as nitric oxide (NO) can act as signal molecules, but because they cannot interact with proteins they must act by affecting membrane lipids

FALSE

Heart muscle cells, salivary glands cells, and skeletal muscle cells all express an acetylcholine receptor that belongs to teh transmitter gated ion channel famil

directly

NO stimulates intracellular enzye guanylyl cyclase by diffusing into a cells and stimulating the cyclase

a subunit exchanges GDP for GTP

When a cell surface receptor activates a G protein what happens

increase in cAMP levels

Adenylyl cyclase =

Membrane potential phospholipids

Ion channels create changes in

cleavage of inositol

Phospholipase C =

steroid hormones

this receptor family interacts with siganl molecules that diffuse through the plasma membrane

FALSE

Heart muscle cells, salivary glands cells, and skeletal muscle cells all express an acetylcholine receptor that belongs to teh transmitter gated ion channel famil

FALSE

Phosphatases remove the phosphate from GTP on GTP binding proteins, turning them off

NOT

dephosphorylation by serine/threonine phosphotases are ____ directly involved in inactivating an activated RTK

mutation inactivates tyrosine phosphatase

What types of mutations would be expectd to promote uncontrolled cell proliferation

two, different

A protein kinase can act as an integrating device in signaling if it is activated by _____ or more proteins in ______________ signaling pathways

NOT

dephosphorylation by serine/threonine phosphotases are ____ directly involved in inactivating an activated RTK

See More

Please allow access to your computer’s microphone to use Voice Recording.

Having trouble? Click here for help.

We can’t access your microphone!

Click the icon above to update your browser permissions above and try again

Example:

Reload the page to try again!

Reload

Press Cmd-0 to reset your zoom

Press Ctrl-0 to reset your zoom

It looks like your browser might be zoomed in or out. Your browser needs to be zoomed to a normal size to record audio.

Please upgrade Flash or install Chrome
to use Voice Recording.

For more help, see our troubleshooting page.

Your microphone is muted

For help fixing this issue, see this FAQ.

Star this term

You can study starred terms together

NEW! Voice Recording

Create Set