Advertisement Upgrade to remove ads

What is the process called that converts the genetic information stored in DNA to an RNA copy?

Lagging strand synthesis would be incomplete; leading strand synthesis would be unaffected.

DNA does not store the information to synthesize which of the following?

Organelles

Transcription begins at a promoter. What is a promoter?

A site in DNA that recruits the RNA Polymerase

Which of the following statements best describes the promoter of a protein-coding gene?

The promoter is a nontranscribed region of a gene

What determines which base is to be added to an RNA strand during transcription

Base pairing between the DNA template strand and the RNA nucleotides

Which of the following terms best describes the relationship between the newly synthesized RNA molecule and the DNA template strand

Complementary

What happens to RNA polymerase II after it has completed transcription of a gene

It is free to bind to another promoter and begin transcription

Given the DNA template shown above, which of the following bases would you find in a complementary RNA strand and where would they be synthesized? (Riboncleotides+RNA Polymearse+DNA strand with Thymine)

A-A-A-A-A; nucleus

What would one expect to find in a transcription bubble

unwound DNA, mRNA, and RNA polymerase

For any given gene, what ultimately determines which DNA strand serves as the template strand?

the base sequence of the gene's promoter

Which three statements correctly describe the processing that takes place before a mature mRNA exits the nucleus?

-Noncoding sequences called introns are spliced out by molecular complexes called spliceosomes.
-A poly-A tail (50-250 adenine nucleotides) is added to the 3' end of the pre-mRNA.
- A cap consisting of a modified guanine nucleotide is added to the 5' end of the pre-mRNA.

If RNA polymerase is missing _____ then transcription initiation would not occur but elongation could.

Sigma

Where does ribosomal subunits form?

Nucleolus

Where does the attachment of an amino acid to tRNA occur?

Cytoplasm

Where does the translation of cytoplasmic prteins occur?

Ribosome

Where does translation of secreted proteins occur?

Rough ER

Where does transcription and RNA prcessing occur?

Nucleolus

Transcription and RNA processsing

Pre-mRNA, snRNA, mRNA

Tranlation

tRNA, rRNA

Not used in protein synthesis

RNA primers

During _____ both the contents of the nucleus and the cytoplasm are divided.

the mitotic phase

During _____ the cell grows and replicates both its organelles and its chromosomes.

Interphase

What is the difference between a chromatid and a chromosome?

A chromatid is one half of a replicated chromosome, whereas a chromosome consists of DNA wrapped around proteins in a highly organized manner.

Which event does not take place before the start of mitosis?

The nuclear envelope disintegrates.

True or false? Mitosis takes place during M phase, which is the longest phase of the cell cycle.

False

Which term describes two recently replicated DNA strands that are joined together just before cell division?

Sister chromatids

During which stage of mitosis are chromosomes lined up in the center of the cell?

Metaphase

Which stage of mitosis is characterized by the disintegration of mitotic spindles and the formation of two new nuclear membranes?

Telophase

To which part of the centromere do mitotic spindle fibers attach during prometaphase?

Kinetochore

During which substage of mitosis do sister chromatids break apart and start moving to opposite poles of the cell?

Anaphase

The direction of synthesis of an RNA transcript is _____.

5' —> 3'

A promoter is _____.

a sequence in DNA that binds RNA polymerase near the site for transcription

Which statement is correct concerning the function(s) of the 5' cap and the 3' poly(A) tail of eukaryotic mRNAs?

Both structures serve as recognition signals for the translational machinery and extend the life span of the mRNA.

What enzyme catalyzes the attachment of an amino acid to tRNA?

aminoacyl-tRNA synthetase

The tRNA anticodon, GAC, is complementary to the mRNA codon with the sequence _____.

CUG

The initiator tRNA attaches at the ribosome's _____ site.

P

During splicing, _____ recognize and remove _____.

snRNPs that make up the spliceosome; introns

In a DNA double helix an adenine of one strand always pairs with a(n) _____ of the complementary strand, and a guanine of one strand always pairs with a(n) _____ of the complementary strand.

thymine ... cytosine

After DNA replication is completed, _____.

each new DNA double helix consists of one old DNA strand and one new DNA strand

The first step in the replication of DNA is catalyzed by _____.

Helicase

The action of helicase creates _____.

replication forks and replication bubbles

Why is the new DNA strand complementary to the 3' to 5' strands assembled in short segments?

DNA polymerase can assemble DNA only in the 5' to 3' direction

The synthesis of a new strand begins with the synthesis of a(n) _____.

RNA primer complementary to a preexisting DNA strand

An old DNA strand is used as a _____ for the assembly of a new DNA strand.

Template

Imagine that the DNA strand shown below serves as the template for DNA synthesis. 5' CATGCATAGA 3' Assuming no errors in DNA synthesis, what would the new DNA look like?

5' TCTATGCATG 3'

What break hydrogen bonds between bases, and binds at the replication fork?

Helicase

What binds ahead of the replication fork, and breaks covalent bonds in DNA backbone?

Topoisemearse

What prevents hydrogen bonds between bases, and binds after the replication fork?

Single stranded binding protein

What is made continuously, only one primer needed, and daughter strand elongates toward the replication fork?

Leading strand

What is made in segments, multiple primers needed, and daughter strand elongates away from the replication fork?

Lagging strand

Leading and lagging strands are synthesized in what direction?

5' to 3'

Recent studies have shown that xeroderma pigmentosum (an error in the nucleotide excision repair process) can result from mutations in one of seven genes. What can you infer from this finding?

There are several enzymes involved in the nucleotide excision repair process.

What would be the consequence(s) for DNA synthesis if DNA ligase were defective?

Lagging strand synthesis would be incomplete; leading strand synthesis would be unaffected.

What would be the consequence(s) for DNA synthesis if primase were defective?

Both leading and lagging strand synthesis would be incomplete.

Which statement is correct concerning DNA synthesis catalyzed by DNA polymerase?

The new DNA strand is synthesized in the 5'→3' direction; the template strand is read in the 3'→5' direction.

DNA polymerases use _____ as their substrate.

deoxyribonucleoside triphosphates (dNTPs)

Toposiomerase works to _____.

prevent twisting of DNA in front of the replication fork

The primers used for DNA synthesis are _____.

short RNA sequences

Okazaki fragments are found _____.

on the lagging strand

What is a telomere?

the ends of linear chromosomes

Why does telomerase need to have a built-in template for DNA synthesis?

Telomerase is involved in adding DNA to the end of the lagging strand.

Nucleotide excision repair _____.

recognizes and repairs thymine dimers in DNA

What does it mean to say that strands in a double helix are anti parallel?

They have opposite directionally, or polarity.

What is not a property of DNA Polymerase?

It is associated with a sliding clamp only on the leading strand.

What is the function of topoisomerase?

Preventing kinks in DNA as the replication fork opens and unwinds.

What is the function or primase?

synthesis of a short section of RNA, complementary to single stranded DNA

Where and how are Okazaki fragments synthesized?

On the lagging strand in a 5'-3' direction

What does Telomerase do?

It adds single stranded DNA to the lagging strand at the end of a linear chromosome

Th three types of RNA polymerase found in eukaryotic cells transcribe different types of genes. What does RNA polymerase 2 produce?

mRNA's

What is an anticodon?

The part of a tRNA that binds to a codon in mRNA

Which the following best describes the composition of DNA monomers?

All of the monomers contain a phosphate group and a nitrogenous base connected to a deoxyribose.

The structure of a double-stranded DNA helix molecule can best be described as a _____.

sugar-phosphate backbone with the bases of the complementary base pairs adenine-thymine and guanine-cytosine projecting toward the inside of the backbone

How does the dNTP monomer get added to the DNA chain?

The 3' carbon of the DNA chain forms a covalent linkage with the phosphate group on the 5' end of the dNTP.

Which of the following statements is true of DNA synthesis?

DNA polymerase requires a single-stranded template plus a primer to synthesize DNA.

Which strand would be synthesized from the following portion of a DNA molecule? 3' AACCGTAATTCG 5'

5' TTGGCATTAAGC 3'

Which of the following statements is true about DNA replication in bacteria and eukarya?

Eukaryotes can have multiple points of origin for DNA synthesis in each individual chromosome.

The following DNA sequence occurs at the start of a DNA strand. Which of the sequences below would be most likely to bind to this sequence to initiate DNA replication?
3' AATTGCAGATTCA 5'

5' UUAACGUCUAA 3'

DNA synthesis is best characterized by which of the following statements?

It is conducted in the 5' to 3' direction in both the lagging and leading strands.

Which of the following represents the correct order of events as they occur in the process of DNA replication?

Helicase opens helix, DNA polymerase III elongates primer and synthesizes leading and lagging strands, DNA ligase links fragments of DNA.

Which of the following enzymes is correctly matched to its function?

DNA polymerase III—adds nucleotides to the lagging strand

The lagging strand is _____.

made up of short DNA/RNA fragments during replication

Which enzyme catalyzes the synthesis of DNA from its own RNA template?

telomerase

During DNA replication, mismatched bases happen approximately once in every 100,000 bases. The exonuclease activity of which enzyme repairs these mismatches?

DNA polymerase III

DNA mutations that alter the sequence can be corrected by excision repair. Which of the following statements is true of this system?

The system detects mutations because they produce an irregularity in the DNA molecule.

Cancer can occur when DNA is damaged. Which of the following statements about the cause of damage to DNA molecules is true?

DNA molecules can break down in the absence of environmental toxins or radiation.

Why are individuals who suffer from xeroderma pigmentosum (XP) incredibly sensitive to DNA damage from UV light?

XP individuals lack one or more enzymes involved in excising damaged DNA bases from the chromosomes.

What is the correct order for the phases of the cell cycle?

S, G2, M, G1

Although the process of chromosome partitioning during mitosis is visible through a light microscope, the process of DNA replication is not. Why?

Chromosomes are too extended during S phase to be seen by light microscopy.

A certain species of animal has six pairs of chromosomes. How many sister chromatids do the nuclei of these animals have during G2 phase?

24

Mitotic spindle fibers are composed of what cellular components?

microtubules

During mitosis, it is necessary for the nuclear envelope of the parent cell to disintegrate. This is accomplished in part by phosphorylation of proteins associated with the nuclear envelope. If the enzyme responsible for that phosphorylation event is inhibited, at which phase of mitosis are cells likely to arrest?

prometaphase

Which of the following conditions will most likely prevent a cell from passing the G1 checkpoint?

DNA is damaged

What mistake during anaphase can contribute to cancer formation?

improper separation of sister chromatids

Many cancers are due to the failure of cells to properly regulate the _____ checkpoint during the cell cycle.

G1

Examine the following DNA sequence: 5' AATTGCGCTTAG 3'. Which of the strands below represents the complementary RNA strand that would be formed from this DNA strand?

3' UUAACGCGAAUC 5'

Transcription normally stops when the _____.

RNA polymerase reaches a termination signal on the DNA that leads to the formation of a hairpin loop

Which of the following statements about transcription in bacteria and eukaryotes is true?

Bacteria and eukaryotes rely on proteins that recognize specific DNA sequences to initiate transcription.

Which of the following enzymes transcribes genes that code for proteins?

RNA polymerase II

Compared to bacteria, eukaryotic transcription is more complex because _____.

the promoters are more diverse and the primary RNA transcript must be extensively processed

How is an mRNA lacking introns produced in a eukaryotic cell?

snRNPs bind to the primary transcript and form the spliceosome.

In a eukaryotic cell, DNA polymerase enzymes are synthesized in the _____.

cytoplasm by ribosomes

Which of the following mRNA sequences could be bound to the tRNA anticodon 3' GGC 5'?

5' CCA 3'

Which of the following statements about peptide bond formation is true?

RNA catalyzes the formation of peptide bonds.

What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5' AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3'?

Six

Which polymers are composed of amino acids?

Proteins

Which of the following is not attached to the central carbon atom in an amino acid?

An oxygen

Which part of an amino acid is always acidic?

Carboxyl functional group

Which monomers make up RNA?

Nucleotides

Which of the following statements about the formation of polypeptides from amino acids is true?

A bond forms between the carboxyl functional group of one amino acid and the amino functional group of the other amino acid.

True or false? Enzymes in the digestive tract catalyze hydrolysis reactions.

True

Proteins are polymers of _____.

Amino Acids

What type of bond joins the monomers in a protein's primary structure?

Peptide

The secondary structure of a protein results from _____.

hydrogen bonds

Tertiary structure is NOT directly dependent on _____.

peptide bonds

_______ structure is the sequence of amino acids in a protein

Primary

________structure is the result of two or more proteins subunits assembling to form a larger, biologically active protein complex

Quaternary

_________structure describes the alpha helix and beta sheets that are formed by hydrogen bonding between backbone atoms located near each other in the polypeptide chain

Secondary

_________structure is achieved when a protein folds into a compact, three dimensional shape stabalized by interactions between side chain R groups of amino acids

Tetirary

What aspects of amino acid structure vary among different amino acids?

The components of the R group

How does the structure of an amino acid enable it to play its most important roles in cells?

The presence of carboxyl and amino groups gives it the ability to form peptide bonds, and its side chain gives it unique chemical properties.

You've just sequenced a new protein found in mice and observe that sulfur-containing cysteine residues occur at regular intervals. What is the significance of this finding?

Cysteine residues are involved in disulfide bridges that help form tertiary structure.

Where does translation take place?

Ribosome

Which nucleic acid is translated to make a protein?

mRNA

Which of the following processes is an example of a post-translational modification?

Phosphorylation

Which of the following steps occurs last in the initiation phase of translation?

The large ribosomal subunit joins the complex.

At which site do new aminoacyl tRNAs enter the ribosome during elongation?

A site

What is meant by translocation?

The ribosome slides one codon down the mRNA.

True or false. A tRNA with an anticodon complementary to the stop codon catalyzes the reaction by which translation is terminated.

False

The wobble hypothesis explains the _____.

ability of some tRNAs to read more than one codon

If the DNA code for a particular amino acid is AGT, then the anticodon on the tRNA would be _____.

AGU

RNA and proteins combine in cells to form structures called ribosomes. Ribosomes contain the active site for peptide bond formation. Based on their chemical structures, do you think protein or RNA molecules actually form the active site within the ribosome

It could be either, because both molecules have catalytic properties.

You have an enzymatic reaction proceeding at the optimum pH and optimum temperature. You add a competitive inhibitor to the reaction and notice that the reaction slows down.
What can you do to speed the reaction up again?

Add more substrate; it will outcompete the inhibitor and increase the reaction rate.

You have added an irreversible inhibitor to a sample of enzyme and substrate. At this point, the reaction has stopped completely.
What can you do to regain the activity of the enzyme?

The enzyme is inactive at this point. New enzyme must be added to regain enzyme activity.

A _______ inhibitor has a structure that is so similar to the substrate that it can bond to the enzyme just like the substrate

Competitive

A _______inhibitor binds to a site on the enzyme that is not the active site

Noncompetitive

Usually a _______ inhibitor forms a covalent bondwith an amino acid side group within the active site, which prevents the substratefrom entering the active site or prevents catalytic activity

Ireversible

The competitior inhibitor competes with the substrate for the _______ on the enzyme

Active Site

When the noncompetitive inhibitor is bonded to the enzyme, the shape of the _____ is distorted

Enzyme

Enzyme inhibitors disrupts normal interactions between an enzyme and its substrate _____.

Substrate

Please allow access to your computer’s microphone to use Voice Recording.

Having trouble? Click here for help.

We can’t access your microphone!

Click the icon above to update your browser permissions above and try again

Example:

Reload the page to try again!

Reload

Press Cmd-0 to reset your zoom

Press Ctrl-0 to reset your zoom

It looks like your browser might be zoomed in or out. Your browser needs to be zoomed to a normal size to record audio.

Please upgrade Flash or install Chrome
to use Voice Recording.

For more help, see our troubleshooting page.

Your microphone is muted

For help fixing this issue, see this FAQ.

Star this term

You can study starred terms together

NEW! Voice Recording

Create Set