Advertisement Upgrade to remove ads

The proteome is all the proteins produced by an organism. The genome is the totality of all genes of an organism. If the proteome is much larger than the genome, which of the following statements would be accurate?

This finding lends support to the one-gene, one-enzyme hypothesis.
Noncoding DNA is important in determining the proteome.
At least in some cases, a single gene must code for more than one protein.
The number of monomeric subunits found in proteins is fewer than the number of monomeric subunits found in genes.

At least in some cases, a single gene must code for more than one protein.

Which answer best explains why errors in transcription might lead to changes in a cell's phenotype?

Changes in mRNA base sequence might result in changes in the DNA base sequence.
Changes in amino acid sequence of protein(s) might result in changes in the DNA base sequence.
Changes in mRNA base sequence might result in changes in amino acid sequences of proteins.
Changes in DNA base sequence might result in changes in mRNA base sequence.

Changes in mRNA base sequence might result in changes in amino acid sequences of proteins.

The idea that the sequence of bases in DNA specifies the sequence of bases in an RNA molecule, which specifies the sequence of amino acids in a protein, is _____.

the central dogma
the one-gene-one-enzyme hypothesis
the Neurospora biosynthetic hypothesis
the neutral theory

the central dogma

Which of the following is not synthesized from a DNA template?

messenger RNA
amino acids
tRNA
ribosomal RNA

amino acids

In the process of transcription, _____.

mRNA attaches to ribosomes
RNA is synthesized
proteins are synthesized
DNA is replicated

RNA is synthesized

What molecule serves as a link between the information-containing macromolecule, DNA, and protein synthesis?

rRNA
mRNA
tRNA
ribosome

mRNA

All three domains (Bacteria, Archaea, and Eukarya) follow the same genetic code. Which of the following statements would most likely be accurate given that information?

The genetic code evolved before DNA replaced RNA as the unit of genetic information.
The genetic code evolved three times.
The genetic code evolved before the different domains diverged.
There were no mutations following the evolution of the genetic code.

The genetic code evolved before the different domains diverged.

Which of the following findings violated the central dogma?

the discovery of RNA viruses that synthesize DNA using reverse transcriptase
the discovery that the Archaea and Bacteria are more distantly related than are Archaea and Eukarya
the discovery of DNA as the unit of genetic inheritance
the discovery of ribozymes

the discovery of RNA viruses that synthesize DNA using reverse transcriptase

True or false? A codon is a group of three bases that can specify more than one amino acid.

True
False

False
A codon is a group of three bases that can specify only one amino acid.

Which of the following statements about mutations is false?

A deletion mutation results in the loss of a base in the DNA sequence.
A knock-out mutation results in a total absence of the mutated protein.
Addition and deletion mutations disrupt the primary structure of proteins.
An addition mutation results in an added base in the DNA sequence.

A knock-out mutation results in a total absence of the mutated protein.

If a DNA sequence is altered from TAGCTGA to TAGTGA, what kind of mutation has occurred?

None.
Deletion.
Addition.
Both addition and deletion.

Deletion

Which mutation(s) would not change the remainder of the reading frame of a gene sequence that follows the mutation(s)?

One addition mutation.
One addition and one deletion mutation.
One addition and two deletion mutations.
One deletion mutation.

One addition and one deletion mutation.

If a mutated DNA sequence produces a protein that differs in one central amino acid from the normal protein, which of the following kinds of mutations could have occurred?

An addition mutation
A deletion mutation.
An addition mutation and a deletion mutation.
None.

An addition mutation and a deletion mutation.

In the figure shown, what would be the base sequence of the mRNA and the amino acid sequence of the protein if the bottom DNA strand serves as the template for transcription?

mRNA: 5' AUGCCCCUGGAGGGGGUUAGACAU 3' Protein: Met-Pro-Leu-Glu-Gly-Val-Arg-His
mRNA: 5' ATGCCCCTGGAGGGGGTTAGACAT 3' Protein: Met-Pro-Leu-Glu-Gly-Val-Arg-His
mRNA: 5' AUGUCUAACCCCCUCCAGGGGCAU 3' Protein: Met-Ser-Asn-Pro-Leu-Gln-Gly-His
mRNA: 5' AUGCCCCUGGAGGGGGUUAGACAU 3' Protein: Tyr-Arg-Leu-Gly-Glu-Val-Pro-Asp

mRNA: 5' AUGCCCCUGGAGGGGGUUAGACAU 3' Protein: Met-Pro-Leu-Glu-Gly-Val-Arg-His

How many amino acids could be specified by a four-base genetic code?

64
16
256
20

4 × 4 × 4 × 4 = 256 is the number of different "words" possible for a code of four bases if the "words" are four bases long.

Each codon shown below specifies an amino acid. For which one is it possible that a change in a single base could create a stop codon?

ACA
ACC
CAC
AAA

AAA

The redundancy of the genetic code is a consequence of _____.

having an equal number of codons and amino acids
having three-letter-long genetic words (codons)
having fewer codons than there are amino acids
having more codons than amino acids

having more codons than amino acids

When an amino acid is specified by more than one codon, what is usually shared by the set of codons that specifies this amino acid?

the entire base sequence
the second base
the first and second bases
the first base

the first and second bases

Given the DNA template shown above, which of the following bases would you find in a complementary RNA strand and where would they be synthesized?

U-U-U-U-U; nucleus
U-U-U-U-U; ribosome
A-A-A-A-A; ribosome
A-A-A-A-A; nucleus

A-A-A-A-A; nucleus

Codons, the three base sequences that code for specific amino acids, are part of _____.

protein
rRNA
mRNA
tRNA

mRNA

Refer to the figure. Determine the amino acid sequence (begining from the start codon) which is coded by the following mRNA sequence: 5'-UCUGAUGGGCUUU-3'.

N-Ser-Asp-Gly-Leu-C
N-Met-Gly-Phe-C
N-Thr-Met-Gly-C
N-Met-Gly-Val-C

N-Met-Gly-Phe-C

Refer to the figure. Transfer RNA contains the anticodon XXX (three-base sequence that is complementary to the mRNA codon). tRNA with which anticodon would transport phenylalanine to the ribosome?

TTT
CCC
AAA
UUU

AAA

Refer to the figure. If a template strand DNA sequence is GAG, then the amino acid it codes for is _____.

methionine
phenylalanine
leucine
glutamic acid

leucine

What does it mean when we say the genetic code is redundant?

More than one codon can specify the addition of the same amino acid.
A single codon can specify the addition of more than one amino acid.
The genetic code is different for different domains of organisms.
The genetic code is universal (the same for all organisms).

More than one codon can specify the addition of the same amino acid.

Genotype is to _____ as phenotype is to _____.

heredity; DNA base sequence
DNA base sequence; amino acid sequence
transcription; amino acid sequence
gene regulation; translation

DNA base sequence; amino acid sequence

Which of the following molecules is not required for translation?

DNA
mRNA
rRNA
tRNA

DNA

The HIV virus that causes AIDS is an RNA virus. What is an RNA virus?

a DNA virus that is acellular and is able to reproduce outside a living cell
an RNA virus that has reverse transcriptase, enabling it to make DNA from RNA
an RNA virus that makes proteins directly from RNA
a DNA virus that uses DNA as a template in the process of translation

an RNA virus that has reverse transcriptase, enabling it to make DNA from RNA

he central dogma has been challenged on several levels (e.g., the discovery of RNA viruses, which use their RNA to directly synthesize proteins; and the discovery of reverse transcriptase, which makes DNA from RNA). Which of the following is another example of an exception to the central dogma?

Chaperone molecules guide the folding of protein molecules.
DNA from viruses can insert themselves into host cell chromosomes.
Prions are infectious protein molecules capable of altering the folding of normal proteins.
Gene mutations result in altered amino acid sequences of proteins.

Prions are infectious protein molecules capable of altering the folding of normal proteins.

Generally speaking, which of the following mutations would most severely affect the protein coded for by a gene?

a base substitution at the beginning of the gene
a base substitution at the end of the gene
a frameshift deletion at the beginning of the gene
a frameshift deletion at the end of the gene

a frameshift deletion at the beginning of the gene

What answer most accurately describes the type of mutation shown?

missense mutation
point mutation
translocation
inversion

point mutation

A point mutation that results in the substitution of one amino acid for another within a protein is a _____.

beneficial mutation
neutral mutation
missense mutation
silent mutation

missense mutation

The original DNA has the base sequence AGCGTTACCGT; a mutation in the DNA strand results in the base sequence AGGCGTTACCGT. What does this tell you about the mutation?

It is a frameshift mutation.
It may result in a single amino acid change in the protein being coded for by this base sequence.
It was a missense mutation.
It was a silent mutation.

It is a frameshift mutation.

Which statement best explains why some changes in DNA sequence do not change the corresponding protein?

They are missense mutations.
The genetic code is redundant.
The genetic code is unambiguous.
They are nonsense mutations.

The genetic code is redundant.

Please allow access to your computer’s microphone to use Voice Recording.

Having trouble? Click here for help.

We can’t access your microphone!

Click the icon above to update your browser permissions above and try again

Example:

Reload the page to try again!

Reload

Press Cmd-0 to reset your zoom

Press Ctrl-0 to reset your zoom

It looks like your browser might be zoomed in or out. Your browser needs to be zoomed to a normal size to record audio.

Please upgrade Flash or install Chrome
to use Voice Recording.

For more help, see our troubleshooting page.

Your microphone is muted

For help fixing this issue, see this FAQ.

Star this term

You can study starred terms together

NEW! Voice Recording

Create Set