Biology Midterm for Mrs. Nolan

112 terms by Saxjazztic 

Create a new folder

Advertisement Upgrade to remove ads

codon

Each set of three nitrogen bases in mRNA is referred to as a(n) ___.

cytosine

Adenine is to thymine as guanine is to ___.

nitrogen bases

Thymine, adenine, guanine and cytosine are classified as ___.

thymine

RNA consists all of the same nitrogen bases as DNA except ___.

tRNA

___ brings amino acids to the ribosomes for the assembly of proteins.

anitcodon

Each set of three nitrogen bases of in DNA is known as a ___.

mRNA

During the process of transcription, DNA serves as the template for making ___.

double helix

The 3-D shape of DNA is referred to as a ___.

single stranded

DNA is to RNA as double stranded is to ___.

a sugar, a phosphate group, and a nitrogen base

A nucleotide consists of ___.

sugar

The part of the molecule for which deoxyribonucleic acid is named is the ___.

cytosine

The amount of guanine in an organism always equals the amount of ___.

guanine-cytosine

Which one of the following nucleotide pair bonds would be found in a DNA molecule?

phosphate molecules and deoxyribose sugars

The backbone of a DNA molecule is made of which two components?

the shape of a double helix

Watson and Crick were the first to suggest that DNA is ___.

nitrogen bases

The pairing of ___ in DNA is the key feature that allows DNA to be copied.

replication

The process by which a DNA molecule is copied is called ___.

deoxyribose sugar and thymine

A DNA nucleotide may be made up of a phosphate group, along with ___.

cell, nucleus, chromosome, DNA, nucleotide

Which series is arranged in order from largest to smallest in size?

TCAAGGTGAACT

The order of bases on a DNA strand is AGTTCCACTTGA. What would the complimentary DNA strand be?

GGATCGA

During DNA replication, a complementary strand of DNA is made for each original DNA strand. Thus, if a portion of the original strand is CCTAGCT, then the new strand will be ___.

guanine : cytosine

adenine : thymine

is single-stranded, contains uracil and contains a different sugar molecule (all of the above)

RNA differs from DNA in that RNA ___.

uracil

In RNA molecules, adenine is complementary to ___.

mRNA

Transcription is the process by which genetic information encoded in DNA is transferred to a(n) ___.

carries an amino acid to its correct mRNA codon

Transfer RNA ___.

ribosomes

In order for protein synthesis to occur, mRNA must migrate to the ___.

Leu-Lys-Cys-Phe

What is the portion of the protein molecule coded for by the piece of mRNA shown in the diagram?

GAG-UUC-ACG-AAG

The tRNA sequence for the mRNA above is ___.

GAG-TTC-ACG-AAG

Which of the following would represent the strand of DNA from which the mRNA strand above was made?

phosphate group

All of the following are different betwen DNA and RNA except the ___.

transcription

Messenger RNA is formed in the process of ___.

at the ribosomes

In which part of the cell does this process shown in Figure 1-1 take place?

amino acid

Structure III in Figure 11-1 represents a(n) ___.

translation

The process illustrated in Figure 11-1 is called ___.

UACCGUAUGUUCAAGCUGCCUC

Using Structure II in Figure 11-1, what is the sequence of the tRNA molecule from left to right?

TACCGTATGTCAAGCCTC

Using structure II in Figure 11-1, what is the sequence of the DNA molecule from left to right?

mRNA

Applicants for the fourth job of the Help Wanted ad in Table 11-1, "Supervisor" could qualify if they were ___.

DNA

Applicants for the third job of the Help Wanted ad in Table 11-1, "Executive Position" could qualify if they were ___.

tRNA

Applicants for the second job of the Help Wanted ad in Table 11-1, "Accuracy and Speed" could qualify if they were ___.

point mutation

A DNA segment is changed from AATTAG to AAATAG. This is a ___.

frameshift mutation

A DNA segment is changed from AATTAGAAATAG to ATTAGAAATAG. This is a ___.

mutagens

X-rays, ultraviolet light and radioactive substances that can change the chemical nature of DNA are classfied as ___.

mutation

Any change in the DNA sequence that also changes the protein it codes for is a ___.

point mutation

A ___ is a change in a single base pair of DNA.

frameshift mutation

A ___ occurs when a single base is added or deleted from DNA.

cell cycle

Among the following, the term that includes the others is ___.

lining up of chromosomes in the cell

By the end of prophase, each of the following has occured except ___.

centrioles

Unlike plant cells, animal calls contain ___.

interphase

The longest phase of the cell cycle is ___.

centromere

A chromatid is attached to a spindle fiber by the ___.

organ system

Which of the following structures is the most complex?

A

Which of the cells depicted in the line graph in Figure 8-8 are most likely concerous?

they died off because the cancerous cells deprived them of nutrients.

If cancer is present, what is the likely explanation for what happened to cells B and D?

anaphase

The cell in diagram 1 is in ___.

2

Mitosis begins with the stage shown in diagram ___.

telophase

The cell shown in diagram 5 is in ___.

C, B, A, D

Which of the following correctly indicates the order in which these events occur?

A

During which stage do the centromeres divide?

heredity

The passing of characteristics from parents to offspring.

crossing over

The exchange of genetic material between homologous chromosomes.

fertilization

The uniting of the male and female gametes.

zygote

The cell produced when a male gamete fuses with a female gamete.

meiosis

The type of cell division that produces gametes.

haploid

A cell that contains one member of each chormosome pair.

homozygous

The alleles present for a trait are the same.

crossing over

When an area of a chromatid is exchanged with the matching area on a chromatid of its homologous chromosome, ___ occurs.

genetic recombination

Crossing over results in a ___.

homozygous

Cells containing two alleles for each trait are described as ___.

an egg

The gamete that contains genes contributed only by the mother is ___.

the transfer of the male pollen grain to the female organ

Pollination can best be described as ___.

meiosis and fertilization

The numbers in Figure 10-1 represent the chromosome number found in each of the dog cells shown. The processes that are occurring at A and B are ___.

alleles

Genes located on homologous chromosomes may have alternate forms that control different forms of a trait. These alternate forms of a gene are called ___.

both

Sister chromatids seperate

meiosis

Haploid cells are formed

mitosis

Cell division only occurs once

meiosis

Homologous chromosomes pair

meiosis

Four cells are the final result

meiosis

Cell division occurs twice

both

Replicated chromosomes line up in the middle of the cell

mitosis

Two cells are the final result

mitosis

Diploid cells are formed

meiosis

Daughter cells have one chromosome from each homologous pair

chlorophyll

The main energy-trapping molecule in plants is ___.

thylakoid membranes

Energy from sunlight is trapped by chlorophyll located in the ___.

energy

Chlorophyll traps ___ from sunlight.

chlorophyll

A green pigment that traps energy from sunlight is ___.

ribose

Which sugar is a part of adenosine diphosphate?

two phosphate groups

Energy is released from ATP when the bond is broken between ___.

a cell can't always immediately use all the energy it gets

Organisms need a way of storing energy because ___.

energy

In order to move molecules in your kidneys, your body needs ___.

light reactions release oxygen

In the complete process of photosynthesis, the ___.

two, four

In glycolysis, ___ molecules of ATP are used in the first step, and ___ molecules of ATP are produced in the second step.

oxygen

In respiration, the final electron acceptor in the electron transport chain is ___.

maintain homeostasis

Kidneys use energy to move molecules and ions in order to keep the blood chemically balanced. This process is an example of cells using energy to ___.

6CO2+6H20--->C6H1206+6O2

Which of the following equations best represents photosynthesis?

reflected

Leaves appear green because the green portion of the light that strikes them is ___.

a third phosphate group is bonded to an ADP molecule

Cells store energy when ___.

burning

The energy in glucose cannot be released by ___.

glucose

Which of the following is not a part of adenosine diphosphate?

B

Which of the diagrams in Figure 9-2 best show how energy is produced in a cell?

production of ATP

What is the main purpose of the cycle shown in Figure 9-4?

animals only

In what types of organisms does the process shown in Figure 9-5 take place?

citric acid cycle

A series of reactions in aerobic respiration that begins and ends with the same 6-carbon compound is the ___.

Calvin Cycle

In photosynthesis, the series of reactions that synthesize simple sugars from carbon dioxide and hydrogen is known as the ___.

glycolysis

The anaerobic process of splitting glucose to form pyruvic acid is called ___.

photolysis

The splitting of water during photosynthesis is ___.

electron transport chain

The passing of electrons along a series of molecules, releasing energy as they go, is known as a(n) ___.

photosythesis

The process by which autotrophs use energy from sunlight to build carbohydrates is called ___.

light dependant reactions

The reactions in photosynthesis in which energy from the sun is converted to chemical energy are called ___.

increases in response to increasing light intensity, but only to a certain point

Graph A demonstrates that the rate of photosynthesis ___.

the rate of photosynthesis is affected by changes in the environment

Taken together, these graphs demonstrate that ___.

Please allow access to your computer’s microphone to use Voice Recording.

Having trouble? Click here for help.

We can’t access your microphone!

Click the icon above to update your browser permissions above and try again

Example:

Reload the page to try again!

Reload

Press Cmd-0 to reset your zoom

Press Ctrl-0 to reset your zoom

It looks like your browser might be zoomed in or out. Your browser needs to be zoomed to a normal size to record audio.

Please upgrade Flash or install Chrome
to use Voice Recording.

For more help, see our troubleshooting page.

Your microphone is muted

For help fixing this issue, see this FAQ.

Star this term

You can study starred terms together

NEW! Voice Recording

Create Set