IB

Created by adrisanti5 

Upgrade to
remove ads

A DNA molecule is made up of repeating units of which of the following?
Choose one answer.
a. amino acids
b. nucleotides
c. polypeptides
d. ribose sugars

nucleotides

A gene can be defined as a discrete piece of chemical information that is actually a code for:

a. translation of DNA molecules.
b. assembly of a hormone.
c. assembly of one protein.
d. the regulation of molecules which direct gene activation.

c. assembly of one protein

A genome is:
Choose one answer.
a. all the DNA in an organism
b. all the alleles in a population.
c. only the expressed genes of an organism.
d. all the dominant alleles of an organism.

all the DNA in an organism Correct

A segment of a DNA molecule that provides the information for the sequence of amino acids for one specific protein is a or an:
Choose one answer.
a. chromosome.
b. gene.
c. nucleotide.
d. enzyme.

b. gene.

An enzyme that can join pieces of DNA together is:
Choose one answer.
a. DNA ligase.
b. RNA polymerase.
c. DNA polymerase.
d. Rubisco.

a. DNA ligase

DNA molecules are constructed from nucleotides that are molecules consisting of:
Choose one answer.
a. a base, deoxyribose sugar, and a nitrate group.
b. a base, deoxyribose sugar, and a phosphate group.
c. a base, ribose sugar, and a sulfur group.
d. an amino acid, a tRNA, and a ribosome.

b. a base, deoxyribose sugar, and a phosphate group.

How do DNA and RNA differ?
Choose one answer.
a. DNA is found only in the cytoplasm; RNA is found only in the nucleus.
b. DNA contains the bases A, T, C, G; RNA contains the bases A, U, C, G
c. DNA is a double helix; RNA cannot complementary base pair with anything.
d. DNA is missing an oxygen atom on the phosphate group.

b. DNA contains the bases A, T, C, G; RNA contains the bases A, U, C, G

How do DNA and RNA differ?
Choose one answer.
a. RNA replicates; DNA does not.
b. RNA is short-lived; DNA is long-lived.
c. RNA is only in the nucleus; DNA is only in the cytoplasm.
d. T occurs in RNA in place of U in DNA.

b. RNA is short-lived; DNA is long-lived.

If a species' DNA contains 30% C (cytosine), what is the percentage of A (adenine)in the DNA?
Choose one answer.
a. 60%
b. 25%
c. 30%
d. 20%

d. 20%

If a species' genome is 20% A (adenine), what is the percentage of G (guanine) in the genome?
Choose one answer.
a. 60%
b. 20%
c. 30%
d. 80%

c. 30%

In DNA, the genetic information is contained in the sequence of:
Choose one answer.
a. amino acids.
b. sugars.
c.itrogenous bases. n
d. phosphates.

c.itrogenous bases. n

In the DNA double helix,:
Choose one answer.
a. the order of bases is exactly the same in all individuals of a species.
b. the backbone is held together by weak hydrogen bonds.
c. Gs always pair with As and Cs always pair with Ts.
d. the backbone is RNA and sugars form the rungs of the ladder.
e. the number of As always equals the number of Ts.

e. the number of As always equals the number of Ts.

In the DNA of cell nuclei, the amount of adenine (A) is the same as the amount of which?
Choose one answer.
a. guanine (G)
b. thymine (T)
c. cytosine (C)
d. uracil (U)

b. thymine (T)

In the genetic code, the alphabet has ________ letters and each word is __________ letters long.
Choose one answer.
a. 3, 61
b. 61, 4
c. 4, 3
d. 64, 3
e. 3, 4

c. 4, 3

In the nuclear DNA of a plant cell, the amount of guanine (G) is the same as the amount of:
Choose one answer.
a. uracil (U).
b. thymine (T).
c. adenine (A).
d. cytosine (C).

d. cytosine (C).

Knowing the genome of rice tells us:
Choose one answer.
a. the nitrogenous base sequence of all the chromosomal material.
b. which genes are being expressed at any one time.
c. how many ribosomes are in the cytoplasm.
d. how many chromosomes are in the nucleus.
e. the nitrogenous base sequence of the expressed genes.

a. the nitrogenous base sequence of all the chromosomal material.

One surprise that came from analyzing the results of the Human Genome Sequencing Project was that:
Choose one answer.
a. we have far more genes than anyone every thought.
b. bacteria have more genes than we do.
c. our genome doesn't resemble those of other mammals at all.
d. we have fewer genes than scientists had predicted.

d. we have fewer genes than scientists had predicted.

Semi-conservative DNA replication is possible because:
Choose one answer.
a. one DNA polymerase molecule can synthesize two DNA strands at once.
b. each cell needs only half as much DNA as its parent cell.
c. transcription uses only the template strand, not the gene strand.
d. one strand has all the information needed to specify a complementary strand.

d. one strand has all the information needed to specify a complementary strand.

The fact that the genetic code is triplet in nature means:
Choose one answer.
a. each nucleotide is read three times.
b. each amino acid is coded for by three codons.
c. codons each consist of three nucleotides.
d. each codon codes for three amino acids.
e. none of these answers are correct.

c. codons each consist of three nucleotides.

The semi-conservative nature of DNA replication results in:
Choose one answer.
a. two completely new DNA strands copied from one old strand.
b. the old DNA being destroyed after replication.
c. two new strands of DNA each paired with one of the old.
d. a reduction of information before cell division.

c. two new strands of DNA each paired with one of the old.

f a species' DNA contains 30% C (cytosine), what is the percentage of A (adenine) in the DNA?

Choose one answer.
a. 25%
b. 60%
c. 20%
d. 30%
e. 80%

20

When DNA is replicated the molecule is first split apart by the action of:
Choose one answer.
a. rRNA.
b. mRNA.
c. an enzyme.
d. tRNA.

c. an enzyme.

Which is NOT one of the events that occur in DNA replication?
Choose one answer.
a. The double strand of DNA opens up into two single strands.
b. Adenine (A) pairs with thymine (T).
c. The old strand of DNA is broken down after being replicated.
d. The entire DNA molecule is replicated.

c. The old strand of DNA is broken down after being replicated.

Which is true about RNA compared to DNA?
Choose one answer.
a. RNA is used to make proteins; DNA is used to make RNA.
b. RNA is double stranded; DNA is single stranded.
c. RNA is found only in the cytoplasm; DNA is found only in the nucleus.
d. RNA has three building blocks; DNA has four.

d. RNA has three building blocks; DNA has four.

Which of the following is a molecule that serves as a building block of DNA molecules and is the basis of genetic information?
Choose one answer.
a. chromosome
b. enzyme
c. gene
d. nucleotide

d. nucleotide

Which sequence is ordered from the least to greatest information content?
Choose one answer.
a. nucleotide, genome, chromosome, gene
b. nucleotide, gene, chromosome, genome
c. genome, chromosome, gene, nucleotide
d. nucleotide, gene, genome, chromosome

b. nucleotide, gene, chromosome, genome

Which would be identical in the nuclei of living cells of both the leaf and the root of the same plant?
Choose one answer.
a. DNA
b. enzymes
c. proteins
d. mRNA

a. DNA

A chemical that destroys ribosome functioning would most IMMEDIATELY affect:
Choose one answer.
a. translation.
b. respiration.
c. DNA replication.
d. transcription.

a. translation

A codon is a sequence of three:
Choose one answer.
a. sugars.
b. proteins.
c. nitrogenous bases.
d. amino acids.

c. nitrogenous bases.

A gene is expressed when it:
Choose one answer.
a. is transcribed into RNA, then translated into a protein.
b. is transcribed into an enzyme that catalyzes a chemical reaction.
c. moves into the cytoplasm and directs a metabolic event.
d. is translated into a hormone.

a. is transcribed into RNA, then translated into a protein.

A molecule that directs cell processes by serving as a catalyst for reactions is a or an:
Choose one answer.
a. nucleotide
b. gene
c. enzyme
d. chromosome

c. enzyme

A protein:
Choose one answer.
a. is formed from sugars and lipids.
b. is a unit of condensed glycerol and fatty acids.
c. contains phosphates, sugars and nitrogenous bases.
d. is a chain of amino acids.

d. is a chain of amino acids.

A ribosome is the cell organelle upon which (the) _______ occurs.
Choose one answer.
a. protein synthesis
b. production of messenger RNA
c. production of transfer RNA
d. synthesis of amino acids

a. protein synthesis

A substance that blocks transcription immediately stops which?
Choose one answer.
a. production of mRNA
b. processing of mRNA
c. attachment of a substrate to an enzyme
d. attachment of tRNA to amino acid

a. production of mRNA

Amino acids are transported to the site of protein synthesis by _______ molecules.
Choose one answer.
a. transfer RNA
b. RNA
c. DNA
d. ribosomal RNA

a. transfer RNA

Arrange the following in the order that they occur during the process of going from the bases to a trait.
1. protein
2. gene
3. transfer RNA
4. messenger RNA
5. amino acid
Choose one answer.
a. 2, 3, 4, 1, 5
b. 1, 2, 4, 3, 5
c. 1, 5, 3, 4, 2
d. 2, 4, 3, 5, 1

d. 2, 4, 3, 5, 1

At the ribosomes ___________ and ___________ come together, enabling the synthesis of ____________.
Choose one answer.
a. nucleotides / DNA / mRNA
b. protein / RNA nucleotides / tRNA
c. mRNA / tRNA / proteins
d. amino acids / nucleotides / DNA

c. mRNA / tRNA / proteins

Below is the template strand of an expressed segment of a DNA molecule. Which mRNA would this sequence specify?
TACGCCAGTGCTATCGATATT
Choose one answer.
a. TACGCCAGTGCTATCGATATT
b. UACGCCAGUGCUAUCGAUAUU
c. AUGCGGUCACGAUAGCUAUAA
d. ATGCGGTCACGATAGCTATAA

c. AUGCGGUCACGAUAGCUAUAA

Each could inhibit protein synthesis EXCEPT:
Choose one answer.
a. making the nuclear membrane impermeable to RNA.
b. missing an essential amino acid from your diet.
c. lacking enough grams of protein per day.
d. a diet containing too much of a non-essential amino acid.

d. a diet containing too much of a non-essential amino acid.

Each sequence of nucleotide bases within one gene contains the information for a sequence of which make up one .
Choose one answer.
a. substrates / product
b. tRNA / mRNA
c. amino acids / protein
d. proteins / enzyme

c. amino acids / protein

Enzymes are important compounds in a plant because they:
Choose one answer.
a. speed up chemical reactions.
b. move throughout the plant and control the development of each tissue.
c. contain the code for protein synthesis.
d. transmit genetic information from one generation to the next.

a. speed up chemical reactions.

For a codon sequence of nucleotide bases AUC, the template or transcribed DNA will have the sequence ___________and the anticodon the sequence ___________.
Choose one answer.
a. TAG / UAG
b. ATC / ATC
c. ATC / UAG
d. UAG / TAG

a. TAG / UAG

Having _________ gives proteins quaternary structure.
Choose one answer.
a. coils with folds
b. several polypeptides associated with one another
c. folded sheets
d. linear chains

b. several polypeptides associated with one another

How many base pairs in a gene are required to encode a protein of 60 amino acids (not including the stop codon)?
Choose one answer.
a. 120
b. 30
c. 60
d. 180

d. 180

In plants, the process of translation occurs:
Choose one answer.
a. on the cell membrane.
b. in the nucleus.
c. on the ribosomes.
d. in the mitochondria.

c. on the ribosomes.

Marks: 1
In translation, the tRNA anticodon ACC is complementary to:
Choose one answer.
a. the stop sequence, UGA.
b. the rRNA anticodon, UGG.
c. the DNA template sequence, UGG.
d. the mRNA codon, UGG.

b. the rRNA anticodon, UGG.

Not all proteins have:
Choose one answer.
a. quaternary structure.
b. peptide bonds.
c. primary structure.
d. amino acids.

a. quaternary structure.

Nucleotides containing ________ are NOT used when DNA is replicated.
Choose one answer.
a. thymine (T)
b. adenine (A)
c. uracil (U)
d. cytosine (C)

c. uracil (U)

Place in order the steps involved in the activation of a gene resulting in the expression of a phenotype.
1. mRNA -> protein 4. internal receptor
2. DNA -> mRNA 5. protein catalyzes reaction
3. external environmental stimulus 6. phenotype expressed

Choose one answer.
a. 3, 4, 2, 1, 5, 6
b. 3, 4, 5, 6, 2, 4
c. 6, 2, 1, 3, 4, 5
d. 4, 3, 2, 1, 5, 6

3, 4, 2, 1, 5, 6

Preliminary to the process of transcription in the nucleus, the two halves of a segment of DNA are split apart (or unzipped) by the action of:
Choose one answer.
a. an enzyme.
b. a nucleotide.
c. messenger RNA.
d. an amino acid

an enzyme.

Replacing one amino acid in a protein molecule with a different amino acid will:
Choose one answer.
a. never change the activity of the protein molecule.
b. result in the protein molecule becoming denatured.
c. always change the activity of the protein molecule.
d. sometimes improve the activity of the protein molecule.

d. sometimes improve the activity of the protein molecule.

RNA molecules are shorter than DNA molecules because:
Choose one answer.
a. RNA replication is liberal, but DNA replication is semi-conservative
b. RNAs don't last very long inside the cell.
c. RNA is harder to synthesize in long lengths.
d. RNA molecules represent small portions of chromosomes

d. RNA molecules represent small portions of chromosomes

Synthesis of a specific protein would be prevented if:
Choose one answer.
a. there is a lack of amino acids in the cytoplasm.
b. following transcription the resulting mRNA is an exact complement of the DNA segment.
c. the newly made mRNA leaves the cell nucleus.
d. hydrogen bonds holding the DNA together break.

a. there is a lack of amino acids in the cytoplasm.

The allele that controls the production of red pigment in the petals of some flowers does so by causing the production of a or (an) ________ that catalyzes the production of the pigment.
Choose one answer.
a. amino acid
b. ribosome
c. nucleotide
d. enzyme

d. enzyme

The assembly of amino acids into protein molecules takes place and is called .
Choose one answer.
a. at the ribosomes / translation
b. in the nucleus / translation
c. in the nucleus / transcription
d. at the ribosomes / transcription

a. at the ribosomes / translation

The fact that the genetic code is triplet in nature means:
Choose one answer.
a. codons each consist of three nucleotides.
b. each amino acid is coded for by three codons.
c. each codon codes for three amino acids.
d. each nucleotide is read three times.

. codons each consist of three nucleotides.

The genetic code that determines the kinds of amino acids in proteins consists of sequences of ____ bases.
Choose one answer.
a. 5
b. 6
c. 3
d. 2

3

The process of gene expression begins with the synthesis of mRNA. This process is called and takes place in the of plant cells.
Choose one answer.
a. translation / nuclei
b. translation / cytoplasm
c. transcription / cytoplasm
d. transcription / nuclei

d. transcription / nuclei

The process of transcription results in the formation of which type of molecule?
Choose one answer.
a. an amino acid
b. a DNA
c. an RNA
d. a polypeptide

c. an RNA

The secondary structure of a protein molecule is described by the:
Choose one answer.
a. helical coiling of the molecule.
b. combination of two or more protein molecules.
c. folding of the molecule.
d. specific sequence of amino acids.

a. helical coiling of the molecule.

The tRNA carrying tryptophan has the anticodon ACC. What is the codon on the mRNA to which the tRNA will attach?

Choose one answer.
a. CCA
b. ACC
c. UGG
d. TGG

ugg

he ___________ transports individual amino acids which are assembled into proteins according to the codon sequence in the__________ .
Choose one answer.
a. tRNA / DNA
b. mRNA / DNA
c. mRNA / rRNA
d. tRNA / mRNA

d. tRNA / mRNA

This semester we covered protein synthesis in detail because:
Choose one answer.
a. proteins are the genetic code of the chromosomes.
b. the information in genomes is expressed in the form of proteins.
c. proteins are genes.
d. proteins make up the codons of RNA.

b. the information in genomes is expressed in the form of proteins.

Transcription results in ______ synthesis whereas translation results in _____ synthesis.
Choose one answer.
a. DNA / RNA
b. RNA / DNA
c. RNA / protein
d. DNA / protein

c. RNA / protein

What do DNA replication, transcription and translation have in common?
Choose one answer.
a. All rely on base-pairing.
b. All use mRNA.
c. All occur only in dividing cells.
d. All occur in the nucleus.

a. All rely on base-pairing

What is the specific location for synthesis of the enzyme amylase in a plant cell?
Choose one answer.
a. nucleus
b. mitochondria
c. ribosome
d. starch grains

c. ribosome

What would be the correct template strand and mRNA transcribed from a DNA molecule with the following gene strand: ACATTAG. (The following pairs are TEMPLATE DNA / mRNA.)
Choose one answer.
a. UGUAAUC / UCUAAUG
b. TGTAATC / ACATTAG
c. ACATTAG / UGUAAUC
d. TGTAATC / ACAUUAG

TGTAATC / ACAUUAG

What would be the fewest number of bases in a gene that codes for the production of a protein 60 amino acids in length?
Choose one answer.
a. 180
b. 60
c. 30
d. 120

180

When a gene is expressed, the process of translation takes place ___________ and results in the production of ___________.
Choose one answer.
a. at a ribosome / a protein molecule
b. in the nucleus / an enzyme molecule
c. at a ribosome / an mRNA molecule
d. in the nucleus / an mRNA molecule

at a ribosome / a protein molecule

Where does translation take place?
Choose one answer.
a. starch grains
b. nucleus
c. ribosome
d. mitochondria

ribosome

Which DNA molecule would encode the same polypeptide as that encoded by the following messenger RNA? (The second series of letters would be immediately below the first set.)

UCUGCUACA (mRNA)
Choose one answer.
a. B . UCUGCUACA AGACGAUGU
b. TGTAGCAGA ACATCGTCT
c. AGACCATGT TCTGGTACA
d. AGTGCGACT TCACGCTGA

AGTGCGACT TCACGCTGA

Which is an INCORRECT comparison of DNA replication to transcription?
Choose one answer.
a. A pairs with T in DNA replication but A pairs with U in transcription.
b. Both strands of DNA are copied in replication, only all of one strand of DNA is used in transcription.
c. Mistakes in DNA replication can eventually lead to mistakes in transcription.
d. Replication occurs in the nucleus; transcription occurs in the cytoplasm.

Replication occurs in the nucleus; transcription occurs in the cytoplasm.

Which of the following best sums up the role of ribosomes?
Choose one answer.
a. mRNA --> protein
b. mRNA --> DNA
c. tRNA --> rRNA
d. mRNA (nucleus) --> mRNA (cytoplasm)

a. mRNA --> protein

Which of the following is NOT needed in the process of translation?
Choose one answer.
a. ribosomes
b. DNA
c. messenger RNA
d. transfer RNA

b. DNA

Which processes involve messenger RNA, transfer RNA, amino acids, and ribosomes?
Choose one answer.
a. transcription
b. meiosis
c. translation
d. DNA replication

translation

A plasmid is:
Choose one answer.
a. all of the DNA in a bacterium.
b. a small circular piece of DNA in a bacterium.
c. a small section of RNA which becomes linked to bacterial DNA.
d. a section of the main chromosome in a bacterium that has broken off.

all of the DNA in a bacterium.

A scientist attempts an experiment to transform tobacco with DNA from corn. One way to check and see if the tobacco plant has incorporated the DNA is to:
Choose one answer.
a. look for artificial chromosomes in both the corn and tobacco.
b. use DNA ligase to join the sticky ends of the corn and tobacco DNA together.
c. isolate a plasmid from tobacco to check for the insert.
d. use a selectable marker, such as antibiotic resistance, along with the corn DNA.

use a selectable marker, such as antibiotic resistance, along with the corn DNA.

Agrobacterium tumefaciens has been useful in plant genetic engineering because it:
Choose one answer.
a. causes tumors and has therefore provided clues for curing cancer in plants.
b. only changes the genotype but never the phenotype of plants it infects.
c. naturally transfers its own DNA to the plant cells that it infects.
d. is a plasmid that naturally occurs in the nuclei of plant cells.

naturally transfers its own DNA to the plant cells that it infects.

Compared to biotechnological approaches, one of the major disadvantages of using traditional methods of plant breeding is that:
Choose one answer.
a. only individual genes can be manipulated by traditional breeding.
b. nutritional characteristics cannot be manipulated by traditional breeding.
c. breeders cannot rely on sexual reproduction of plants.
d. the process of traditional breeding is very slow.

the process of traditional breeding is very slow. Correct

For recombinant DNA techniques to be successful which of the following must occur?
Choose one answer.
a. The foreign DNA inserted must be transcribed and translated into a protein by the host cell.
b. The original genetic information of the host must be removed from the host cell.
c. Messenger RNA must be inserted in addition to DNA.
d. The inserted DNA must be from the same species as the host DNA.

The foreign DNA inserted must be transcribed and translated into a protein by the host cell.

How is genetic engineering the same as traditional breeding methods?
Choose one answer.
a. Both take a long time to produce desired phenotypes.
b. Both guarantee the desired genetic result.
c. Both result in a change in the genetic information.
d. Both combine information from unrelated organisms.

Both result in a change in the genetic information.

If an organism has been genetically transformed, then:
Choose one answer.
a. its genome has a lot of mutations.
b. a researcher has stably incorporated new DNA into it.
c. it is resistant to antibiotics.
d. it has evolved into an entirely new species.

a researcher has stably incorporated new DNA into it.

n order to carry out recombinant DNA experiments, one at least needs:
Choose one answer.
a. restriction enzymes, DNA ligase and plasmids.
b. DNA polymerase, RNA polymerase, and tRNAs.
c. rRNA, mRNA, and tRNA.
d. DNA, RNA, and protein.

restriction enzymes, DNA ligase and plasmids

In order to stably introduce a gene from a bacterium into corn, one might:
Choose one answer.
a. isolate the gene with restriction enzymes and use the DNA gun to introduce it into corn.
b. dip the corn flowers in a suspension made from a dried bacterial culture.
c. grow corn for many generations in the habitat to which the bacteria are adapted.
d. treat the corn with hormones to soften its cell walls for entry of Agrobacterium tumefaciens.

isolate the gene with restriction enzymes and use the DNA gun to introduce it into corn.

n plant tissue culture, a callus is:
Choose one answer.
a. unorganized growth of plant cells that form a tumor-like cell mass.
b. a plant cell whose wall has been removed using enzymes.
c. formation of an embryo from individual somatic (non-gametic) cells.
d. a growth on the meristem formed from pushing through the soil.

unorganized growth of plant cells that form a tumor-like cell mass

in recombinant DNA experiments, small DNA fragments are cut out of larger DNA molecules using:
Choose one answer.
a. microscapels.
b. enzymes.
c. DNA ligase.
d. lasers.

. enzymes.

In recombinant DNA experiments, ______ is used to cut pieces of DNA and ______ joins the resulting fragments to form recombinant DNA.
Choose one answer.
a. DNA polymerase / a restriction enzyme
b. a plasmid / DNA ligase
c. a restriction enzyme / DNA ligase
d. DNA ligase / restriction enzyme

a restriction enzyme / DNA ligase

n recombinant DNA techniques the ultimate goal is the introduction of a desired gene from species X to species Y. Which is the proper order of steps to genetically engineer species Y?
1. insert recombinant plasmid into Agrobacterium
2. choose and isolate desired gene
3. produce calluses
4. insert desired gene into plant cell chromosome
5. cut and insert desired gene in plasmid
6. produce adult plant with desired gene
7.identify recombinant plasmid
Choose one answer.
a. 1, 2, 3, 4, 5, 6, 7
b. 1, 7, 2, 4, 3, 6, 5
c. 4, 2, 7, 6, 3, 5, 1
d. 2, 5, 7, 1, 4, 3, 6

. 2, 5, 7, 1, 4, 3, 6

n recombinant DNA, the function of vectors, such as plasmids, is to:
Choose one answer.
a. cut chromosomes at specific sites.
b. move genes into different genomes.
c. produce sticky ends on genes.
d. identify desired genes in bacteria.

. move genes into different genomes.

Intact plants can be regenerated from plant tissue cultures because plant cells are:
Choose one answer.
a. genetically transformed.
b. always dividing.
c. resistant to antibiotics.
d. totipotent.

totipotent.

Modern genetic engineering methods differ from natural or traditional methods of plant breeding in that modern methods:
Choose one answer.
a. move individual genes into a target organism.
b. produce new varieties of existing species.
c. produce organisms with improved characteristics.
d. produce hybrids between species.

move individual genes into a target organism.

One advantage of recombinant DNA technology over traditional methods of plant breeding is that it:
Choose one answer.
a. doesn't require the use of vectors such as Agrobacterium tumefaciens
b. can change the genetic makeup of a crop, but traditional breeding cannot.
c. frees the breeder from ever having to do traditional crossing and selection.
d. can be used to manipulate genes one at a time.

can be used to manipulate genes one at a time.

One benefit to the farmer of using crops modified with herbicide and pesticide resistance is that:
Choose one answer.
a. they eliminate some passes with heavy machinery, reducing soil compaction.
b. the farmer saves money by not having to use any fertilizer or irrigation.
c. seeds are cheaper than conventional hybrids and can be saved every year.
d. reduced biodiversity always lowers the crop

they eliminate some passes with heavy machinery, reducing soil compaction.

One danger of the widespread adoption by farmers of crop varieties genetically engineered to resist herbicides is that:
Choose one answer.
a. farmers will have to increase herbicide dosages to kill the weeds.
b. crop varieties have to be re-engineered every year to maintain resistance.
c. farmers will keep seeds and reduce profit margins of seed companies.
d. weeds will become herbicide-resistant due to repeated use of a single herbicide.

weeds will become herbicide-resistant due to repeated use of a single herbicide.

One of the major disadvantages of using traditional methods of sexual reproduction to breed plants is:
Choose one answer.
a. identical materials can be propagated without the plant finishing its life cycle.
b. individual genes can be manipulated.
c. the process is very slow.
d. complex characteristics can be manipulated all at once.

the process is very slow

One recombinant DNA technique used in transforming a dicot plant requires __________ to transfer specific genes to the nuclei of the recipient plant.
Choose one answer.
a. Agrobacterium tumefaciens
b. cross pollination
c. ribosomes

Agrobacterium tumefaciens

One surprise that came from analyzing the results of the Human Genome Sequencing Project was that:
Choose one answer.
a. we have far more genes than anyone every thought.
b. we have fewer genes than scientists had predicted.
c. our genome doesn't resemble those of other mammals at all.
d. bacteria have more genes than we do.

we have fewer genes than scientists had predicted.

Put the following steps of the transformation of a eudicot plant with a foreign gene using Agrobacterium tumefaciens in the correct sequence.
1) Insert the foreign gene into a plasmid.
2) Transformed plant cells express the foreign gene.
3) Bacterial cells invade plant cells.
4) Foreign DNA is transferred to a plant chromosome.
Choose one answer.
a. 1, 3, 4, 2
b. 3, 2, 1, 4
c. 3, 1, 4, 2
d. 3, 1, 4, 2

a. 1, 3, 4, 2

Recombinant DNA techniques have much in common with the older techniques of selective breeding. Which of the following statements is TRUE of ONLY the newer techniques (but not the older techniques)?
Choose one answer.
a. New genetic combinations are created.
b. New varieties are created.
c. Mass production is fast.
d. Many years of research are required.

Mass production is fast.

Restriction enzymes:
Choose one answer.
a. are present in the epidermis to restrict mineral movement.
b. are used to cut DNA molecules at specific nucleotide sequences.
c. are used to synthesize DNA molecules.
d. digest stored protein in endosperm.

are used to cut DNA molecules at specific nucleotide sequences.

The key characteristic of Agrobacterium tumefaciens that has made it so valuable for plant genetic engineering is that it:
Choose one answer.
a. only infects grasses such as corn and wheat.
b. transfers DNA into its host plant.
c. carries antibiotic resistances.
d. causes the plant genome to fragment into useful sized plasmids.

transfers DNA into its host plant

The 'DNA-gun' can be used to introduce foreign DNA into plant cells by:
Choose one answer.
a. a virus which injects recombinant DNA through the cell membrane.
b. firing DNA-coated microscopic pellets into plant cells at high velocity.
c. the discharge of an slingshot which propels nuclei toward plant cells.
d. bacteria which infect the plant cell.

firing DNA-coated microscopic pellets into plant cells at high velocity

When bacterial cells are transformed with foreign DNA, this DNA often contains an antibiotic-resistance gene to:
Choose one answer.
a. allow selection for those cells which have incorporated the foreign DNA.
b. increase DNA replication.
c. increase the rate of DNA incorporation into chromosomes.
d. prevent the cells from becoming infected with pathogens.

allow selection for those cells which have incorporated the foreign DNA.

When creating recombinant DNA, which is the proper sequence?
Choose one answer.
a. restriction enzyme -> DNA ligase -> sticky ends -> restriction sequence
b. DNA ligase -> sticky ends -> restriction enzyme -> translation
c. DNA ligase -> restriction sequence -> tRNA -> translation
d. restriction enzyme -> restriction sequence -> sticky ends -> DNA ligase

restriction enzyme -> restriction sequence -> sticky ends -> DNA ligase

When plant cells are transformed with foreign DNA, this DNA often contains an antibiotic-resistance gene to:
Choose one answer.
a. increase the rate of DNA incorporation into the plant chromosomes.
b. increase DNA replication.
c. allow selection for those plant cells which have incorporated the foreign DNA.
d. prevent the plant cells from becoming infected with pathogens.

allow selection for those plant cells which have incorporated the foreign DNA

Which best describes a plasmid?
Choose one answer.
a. DNA found in a plant nucleus
b. recombinant DNA
c. strands of DNA
d. small, circular DNA found in bacteria

small, circular DNA found in bacteria

Which is a valuable application of biotechnology?
Choose one answer.
a. plants used as chemical factories
b. increased use of monocultures
c. abandonment of natural resources
d. conflict over gene ownership

plants used as chemical factories

Which is an example of activation tagging in DNA?
Choose one answer.
a. Soybeans with the ability to withstand herbicide applications.
b. Promoter genes inserted into the rice genome that turn on previously unexpressed genes similar to those expressed in corn.
c. Daffodil genes inserted into the rice genome to increase nutritional content.
d. Rice genes shot into corn cells that are expressed in mature corn plants.

b. Promoter genes inserted into the rice genome that turn on previously unexpressed genes similar to those expressed in corn.

Which is an example of recombinant DNA?
Choose one answer.
a. a plasmid consisting of DNA from two different sources
b. a gene that carries a major mutation
c. a genome cut with an endonuclease
d. bacterial genome with plasmid DNA

a plasmid consisting of DNA from two different sources

Which is the correct statement about both selective breeding and recombinant DNA?
Choose one answer.
a. They assure that the desired genes will be expressed.
b. They require little time before results are achieved.
c. They can be used to produce new genetic combinations.
d. You know exactly what the offspring will be.

hey can be used to produce new genetic combinations

Which of the following can be used to move genes in genetic engineering of plants?
Choose one answer.
a. virus and fungi
b. gene gun and plastid
c. gene gun and plasmid
d. bacteria and mitochondria

gene gun and plasmid

Which of the following segments of double-stranded DNA is most likely to be a restriction enzyme recognition site?
Choose one answer.
a. GCTTGC / CGAACG
b. GCATGC / CGTACG
c. AAAAAA / TTTTTT
d. ACGTAC / TGCATG

GCATGC / CGTACG

Which statement best describes transformed plants?
Choose one answer.
a. They are resistant to infection by Agrobacterium tumefaciens.
b. They contain DNA from a different source than themselves.
c. They contain DNA that has undergone a mutation.
d. They incorporate changes in DNA that occur naturally although rarely.

They contain DNA from a different source than themselves.

Which term or phrase describes the ability of a cell to provide information for the development of an entire organism?
Choose one answer.
a. totipotency
b. transgenic
c. universal DNA code

. totipotency

Why does transformation with Agrobacterium tumefaciens work with only a limited number of organisms?
Choose one answer.
a. Animals have cell walls that make infection by A. tumefaciens difficult.
b. A. tumefaciens cannot infect a previously wounded plant.
c. A. tumefaciens is a disease organism of eudicot plants.
d. A. tumefaciens is not commonly found in nature.

A. tumefaciens is a disease organism of eudicot plants.

Why is producing improved plants through recombinant DNA technology considered to be a valuable alternative to traditional methods of crop breeding?
Choose one answer.
a. Recombinant DNA methods for crop improvement do not require that a specific gene be isolated before it can be modified.
b. Genetically engineered plants are always antibiotic resistant.
c. Recombinant DNA methods produce altered crops faster than traditional breeding methods.
d. Recombinant DNA methods cause changes throughout the genome of the crop plant but traditional breeding affects only single, specific genes.

Recombinant DNA methods produce altered crops faster than traditional breeding methods

A useful application of the terminator gene might be its:
Choose one answer.
a. ability to continuously kill invading insects.
b. ability to grow successive generations containing the gene.
c. usefulness for agriculture in developing countries.
d. ability to reduce gene flow between medicinal crops and nearby food crops.

ability to reduce gene flow between medicinal crops and nearby food crops

Among the top concerns associated with the Bt gene is:
Choose one answer.
a. genetic contamination of wild varieties of non-GM corn individuals.
b. development of more herbicide resistant corn.
c. increased biodiversity of corn.
d. complete eradication of the European corn borer.

genetic contamination of wild varieties of non-GM corn individuals

Because corn is ___________, it easily leads to genetic pollution of non-GM corn populations.
Choose one answer.
a. a monocot
b. a food crop around the world
c. monoecious
d. wind pollinated

d. wind pollinated

Boycotting GM crops is difficult for concerned consumers because:
Choose one answer.
a. interest in such movements have been dying out.
b. few cases of toxic effects on humans have been documented.
c. biotechnology companies have kept their products secret.
d. most foods in the US are unlabeled regarding their GM status.

most foods in the US are unlabeled regarding their GM status.

Bt (Bacillus thurengiensis) toxin can potentially be very useful because:
Choose one answer.
a. Bt toxin will not harm insects, only plants.
b. plants can be engineered to produce it and thus become resistant to some herbivores.
c. it is very easy to place its gene into the genome of Agrobacterium tumefaciens.
d. scientists can use it to help eliminate harmful insect species.

plants can be engineered to produce it and thus become resistant to some herbivores

Genetically modifying soybeans so they are resistant to herbicides means that:
Choose one answer.
a. soybeans in the field will not be affected when the field is treated to remove weeds.
b. consumers of Roundup Ready soybean products will better digest their vegetables.
c. they have the potential of becoming "super weeds."
d. there will be no need to chemically treat agricultural field with herbicides.

a. soybeans in the field will not be affected when the field is treated to remove weeds.

How do genes escape from crops into weeds and other plants in the environment?
Choose one answer.
a. The genes move into the soil and are picked up through the roots.
b. They bribe the guard cells.
c. Cross-pollination by pollen from crop plants with nearby wild varieties.
d. Insects feeding on a plant leave genes behind from previous meals.

Cross-pollination by pollen from crop plants with nearby wild varieties

How do herbicide-resistant weeds come about?
Choose one answer.
a. Common weeds are exposed to X-rays leading to mutations conferring super strength.
b. Herbicide resistant genes from crop plants come into the weed population through hybridization.
c. Gene flow of genes conferring strength into common weeds from wild populations of closely related plants leads to the super condition.
d. Scientists genetically modify common weeds leading to the super condition.

. Herbicide resistant genes from crop plants come into the weed population through hybridization. Correct

One benefit to the farmer of using crops modified with herbicide and pesticide resistance is that:
Choose one answer.
a. the farmer saves money by not having to use any fertilizer or irrigation.
b. seeds are cheaper than conventional hybrids and can be saved every year.
c. the crops produce cleaner fields which always reduces soil erosion.
d. they eliminate some passes with heavy machinery, reducing soil compaction.
e. reduced biodiversity always lowers the crop's susceptibility to disease

they eliminate some passes with heavy machinery, reducing soil compaction

One danger of the widespread adoption by farmers of crop varieties genetically engineered to resist herbicides is that:
Choose one answer.
a. farmers will keep seeds and reduce profit margins of seed companies.
b. engineered plants are susceptible to diseases that they otherwise resist.
c. crop varieties have to be re-engineered every year to maintain resistance.
d. resistant weeds are selected by repeated use of a single herbicide.
e. farmers will have to increase herbicide dosages to kill the weeds.

resistant weeds are selected by repeated use of a single herbicide

What is a "terminator gene" and why is it used? When activated,:
Choose one answer.
a. it produces a pesticide that kills feeding insects. This reduces crop loss.
b. the plant dies. This reduces weeds that compete with the crop.
c. it produces a toxin that moves into the soil. This reduces loss from soil insects.
d. it makes seeds sterile. This prevents gene escape.

it makes seeds sterile. This prevents gene escape.

What test is often employed to check for the presence of possible allergens in GM foods?
Choose one answer.
a. toxic response in mice
b. years of clinical studies on patients
c. amino acid sequence
d. nutritional composition

. amino acid sequence

Which is a valuable application of biotechnology?
Choose one answer.
a. conflict over gene ownership
b. plants used as vaccine delivery
c. increased chemical use
d. increased use of monocultures

. plants used as vaccine delivery

Which of the following is a goal that has been reached by the use of biotechnology?
Choose one answer.
a. Crop plants have been made with resistance to some diseases.
b. Biotechnology in developing countries is affordable.
c. New products have broken our dependence on pesticide use in agriculture.
d. Gene flow between crops and weeds has been successful.

Crop plants have been made with resistance to some diseases.

Which of the following is a practice instituted to delay the evolution of resistance in pest populations to pesticide produced by transgenic crops?
Choose one answer.
a. Fine farmers who save seeds to use in the future.
b. Design crop plants so that the pesticide produced targets a narrower group of pests.
c. Mandate a genetic refuge of non-GM crops near the GM crop.
d. Mandate restrictions against growing GMOs near wild relative

Mandate a genetic refuge of non-GM crops near the GM crop.

Which statement about the use of genetically engineered crop plants is TRUE?
Choose one answer.
a. There is a no risk that marker genes, such as antibiotic resistance, will move into soil bacteria.
b. The demand for crop plants in developing nations is high and is influencing the type of plants being produced through genetic engineering.
c. Research has shown gene escape from crop plants to wild relatives does not happen.
d. Gene escape from engineered crop plants is primarily through vegetative propagation.

The demand for crop plants in developing nations is high and is influencing the type of plants being produced through genetic engineering

Which statement could you use to argue in favor of GM crops?
Choose one answer.
a. GM food products are clearly labeled to allow consumers to avoid them.
b. There is no evidence that genes have moved from GM plants to non-GM plants.
c. People in Europe have found GM foods to be safe.
d. People in the U.S. have been consuming them for years with no apparent problems.

People in the U.S. have been consuming them for years with no apparent problems

Why has the Bt gene been inserted into several crop plants?
Choose one answer.
a. It increases the nutritional value of the crop.
b. It gives the plant resistance to a viral disease.
c. It makes the crop herbicide-resistant.
d. It kills the caterpillars that eat the crop.

It kills the caterpillars that eat the crop.

With the use of bioengineered crop plants, resistant pest populations become a real possibility. Which of the following is a techniques used to reduce the affect of resistant pest populations?

Choose one answer.
a. Decreasing the use of chemical pesticides
b. Growing crops in a region with many weedy relatives
c. Using antibiotic markers to track escapes
d. Establishing crop genetic refuge populations
e. Increasing the use of monocultures

Establishing crop genetic refuge populations

A disadvantage of using algae as a biofuel is:
Choose one answer.
a. it doesn't work as a biofuel.
b. technology is still being developed.
c. competition with foodstock plants for arable land.
d. a negative impact on fresh water resources.
e. a very low yield/acre compared to second generation biofuels.

b. technology is still being developed.

A major difficulty in the production of cellulosic ethanol is:
Choose one answer.
a. it can't be blended with gasoline.
b. a lack of plant material that can be used in the process.
c. transforming sugar to starch.
d. breaking down the cell wall to products ready for respiration.
e. the flammability of ethanol.

breaking down the cell wall to products ready for respiration

A new technological challenge in the production of cellulosic ethanol is:
Choose one answer.
a. the explosive flammability of lignin.
b. improving the efficiency of breaking down cell walls.
c. finding feedstock species that grow outside the tropics.
d. finding a way to transform sugar into starch.
e. to synthesize it to have more energy than gasoline.

improving the efficiency of breaking down cell walls

An advantage to using perennial grasses for biofuel feedstocks is:
Choose one answer.
a. they are harvested just like corn and soybeans.
b. they aren't as tall and cumbersome as biodiesel crops.
c. they can only be grown by family farmers, not by corporations.
d. less soil carbon is released because plowing is reduced.
e. they require no fertilizer at all.

less soil carbon is released because plowing is reduced

Biodiesel can be made from:
Choose one answer.
a. corn stover, switchgrass, and miscanthus.
b. waste vegetable oil, soy beans, and palm oil.
c. cellulosics, sugar cane bagasse, and soy beans.
d. corn kernels, hybrid poplar, and algae.
e. waste rubber, switchgrass, and jojoba.

waste vegetable oil, soy beans, and palm oil.

Cellulose is a major component of:
Choose one answer.
a. DNA.
b. lipids and fats.
c. plant membranes.
d. plant cell walls.

plant cell walls.

How are corn stover and sugar cane bagasse similar?
Choose one answer.
a. Both are waste products of crop production.
b. Both are used in the production of biodiesel.
c. Both come from eudicot plants.
d. Neither can be used in the cellulosic process of ethanol production.
e. Both are raw products used in Brazil for ethanol production.

Both are waste products of crop production

Which country listed is the top producer of ethanol in the world?
Choose one answer.
a. Russia
b. France
c. India
d. China
e. Brazil

e. Brazil

Which is FALSE about the use of biofuels?
Choose one answer.
a. Large quantities of water are used in the production of biofuels.
b. Using crops like corn and sugar cane in the biofuel process reduces the acreage put into food production.
c. Biofuel combustion results in better air quality than fossil fuel combustion.
d. Cultivation of crops for biodiesel production may lead to a loss of biodiversity.
e. Annual biofuel crop production emits fewer greenhouse gases than perennial biofuel crop production.

Annual biofuel crop production emits fewer greenhouse gases than perennial biofuel crop production.

Which plant yields the most energy?
Choose one answer.
a. sugar cane
b. corn
c. sugar beets
d. soybeans
e. switchgrass

e. switchgrass

Which two processes that we have studied this year are important to the production of biofuels?
Choose one answer.
a. enzymatic activity and anaerobic respiration
b. climate change and nutrient cycling
c. photosynthesis and irrigation
d. anaerobic respiration and decomposition
e. genetic engineering and fertilizer use

. enzymatic activity and anaerobic respiration

At 30o latitude, one would expect southern Florida to be a desert. Why is that NOT the case?
Choose one answer.
a. Canals bring water to the Sea of Grass.
b. Ocean currents bring in moisture.
c. Warm, dry air currents are descending.
d. It is on the front side of a rain shadow.
e. Water from Lake Okeechobee is used for irrigation.

b. Ocean currents bring in moisture.

Clearing of the rain forest areas of the world is predicted by some experts to result in the gradual warming of the earth because of the production of ________ by the processes of ________ and __________.
Choose one answer.
a. oxygen / combustion / decomposition
b. carbon dioxide / photosynthesis / decomposition
c. carbon dioxide / decomposition / combustion
d. oxygen / respiration / combustion
e. oxygen / photosynthesis / decomposition

carbon dioxide / decomposition / combustion

Climate results from the combined effect of several physical laws. Which 'law' is stated INCORRECTLY?
Choose one answer.
a. Water changes temperature more quickly than land.
b. Hot air rises.
c. As air rises, it contracts and cools.
d. Air picks up moisture as it moves over water.
e. Hot air holds more moisture than cold air.

Water changes temperature more quickly than land

See More

Please allow access to your computer’s microphone to use Voice Recording.

Having trouble? Click here for help.

We can’t access your microphone!

Click the icon above to update your browser permissions above and try again

Example:

Reload the page to try again!

Reload

Press Cmd-0 to reset your zoom

Press Ctrl-0 to reset your zoom

It looks like your browser might be zoomed in or out. Your browser needs to be zoomed to a normal size to record audio.

Please upgrade Flash or install Chrome
to use Voice Recording.

For more help, see our troubleshooting page.

Your microphone is muted

For help fixing this issue, see this FAQ.

Star this term

You can study starred terms together

NEW! Voice Recording

Create Set