Advertisement Upgrade to remove ads

CellBio Chp10

Hershey and Chase were able to differentiate between proteins and nucleic acids using radioactive atoms of elements found only in those macromolecules. Which of the following would be found only in proteins?

sulfur

In DNA, one nucleotide monomer is linked to the next through _____

covalent bonds between the sugar of one nucleotide and the phosphate of the next

Which of the following is found in RNA but not in DNA

an additional hydroxyl group

What amount of thymine would be found in a strand of DNA composed of 15% cytosine?

35%

Which of the following is true about double-stranded DNA?

Its width is about 2 nm.

During replication, the original "parent" DNA _____

serves as the template for the creation of two complete sets of DNA

Prokaryotic organisms have a single origin of replication, whereas eukaryotic organisms have many origins where replication occurs simultaneously. Which of the following is the most probable reason for this observation?

Prokaryotic DNA is much smaller than eukaryotic DNA.

Which of the following occurs during DNA replication?

DNA polymerase elongates the daughter strand, adding new nucleotides to the 3′ end of the molecule. The molecule grows 5′ to 3′ but is therefore read 3′ to 5′.

In eukaryotes, translation is initiated only after transcription is completed. However, prokaryotes can initiate translation before a gene is completely transcribed. Which choice is the best explanation for this observation?

Translation cannot occur until the RNA leaves the nucleus in eukaryotes.

A new organism is discovered that has six different nucleotides that encode 30 different amino acids. Which of the following nucleotide combinations would encode the minimum number of amino acids needed in this organism?

two-nucleotide sequence

Consider the following sequence and explain what effect the mutation has on the protein that is translated.

UCUAUGUUUCACAGAGGGAAACCCUAACCC (wildtype)
UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant)

prematurely stops the translation of the protein

In transcription, _____

RNA polymerase links nucleotides to form mRN

In eukaryotic cells, a terminator in mRNA synthesis is _____.

a specific nucleotide sequence in DNA that signals the RNA polymerase to stop

In eukaryotic cells, the RNA is processed before it leaves the nucleus. This processing _____.

includes the addition of a cap and tail, which protect the mRNA molecule from enzymatic attack, and the removal of introns

What would be the anticodon for the DNA sequence CTC?

CUC

If protein production were an assembly line, a ribosome would be _____.

the worker who puts all of the pieces together

At the start of translation, where does the initiator tRNA bind?

start codon on the mRNA molecule

The translation process in eukaryotes requires all of the following: _____.

transfer RNA, ribosomes, AUG codons

In eukaryotes, the process of transcription is controlled by _____

DNA

The type of mutation is represented below is a(n) _____.

The big red fly had one eye (wild type)
The fbi gre dfl yha don eey (mutant)

shift in reading frame

During the lytic cycle, but not the lysogenic cycle, _____.

whole viruses leave the host cell to infect other cells

HIV enters a white blood cell and then uses _____ to make copies of its genetic material. Once HIV proteins have been translated, the virus can be released by _____.

a virally encoded reverse transcriptase ... a process known as budding where the virus coats itself in the host cell's plasma membrane

Emerging viruses can originate from _____.

a virus spreading from one host species to another

The drug AZT was one of the first drugs used to treat HIV. Which of the following drug actions would prevent the spread of HIV without harming the host cell?

inhibition of reverse transcriptase

Radiation is a frequent method of sterilization. It is effective because it causes damage to DNA. However, prions, the agents that cause diseases such as mad cow disease, are unaffected by these treatments. Why?

Prions are proteins that are folded incorrectly.

A microbiologist found that a colony of bacterial clones infected by a phage had developed the ability to make a particular amino acid that the bacteria could not make before the infection. This new ability was probably a result of _____.

transduction

Conjugation is a very effective process for spreading antibiotic resistance. Which statement best explains this observation?

Two different strains of bacteria can transfer DNA during conjugation.

A uracil nucleotide is a _____ nitrogenous base attached to the _____, with the 5′ carbon of the sugar attached to a phosphate group.

one-ringed ... carbon of a sugar that has an OH group at the 2′ carbon

Meselson and Stahl's experiment for DNA replication used a radioactive, heavier form of nitrogen. Bacterial cells were grown in this radioactive form of nitrogen until all the DNA contained the heavy form. The bacteria were then transferred to new media without this radioactive form and allowed to reproduce. The first centrifugation demonstrated _____ density DNA bands; the second spin showed _____ density DNA bands

intermediate ... light and intermediate

The information carried by a DNA molecule is in _____.

the order of the nucleotides in the molecule

How does RNA polymerase know where to start transcribing a gene into mRNA?

It starts at a certain nucleotide sequence called a promoter.

After an RNA molecule is transcribed from a eukaryotic gene, portions called _____ are removed and the remaining _____ are spliced together to produce an mRNA molecule with a continuous coding sequence.

introns ... exons

Which one of the following is true of tRNAs?

Each tRNA binds a particular amino acid.

In the lysogenic cycle, the new viral particles are _____

packaged and released when triggered by radiation or chemicals

Before a DNA virus is assembled and leaves the cell, a number of processes occur. Place these steps into the order in which they occur:
1. Viral DNA is replicated using host cell enzymes.
2. Viral receptors bind to host glycoproteins on the cell membrane.
3. Viral RNA is translated.

2, 1, 3

HIV and phage lambda both _____.

integrate their DNA into the host's chromosome

Frederick Griffith was one of the leading scientists looking at the genetic role of DNA. He was working on two strains of Streptococcus pneumoniae: The rough strain (R) did not cause pneumonia, but the smooth form (S) did. When he heat-killed the S strain and gave both this and the R form to mice, the mice developed pneumonia and died. Why?

Even though the S strain had been heat-killed, it changed the R strain.

In an important experiment, radioactively labeled bacteriophages were allowed to infect bacteria. In the first trial, the phages contained radioactive DNA, and radioactivity was detected in the bacteria. Next, other phages containing radioactive protein were allowed to infect bacteria, and radioactivity was not detected in the bacteria. These experiments led to the conclusion that _____.

the genes of this phage were made of DNA

Scientists have discovered how to put together a bacteriophage with the protein coat of phage T2 and the DNA of phage T4. If this composite phage were allowed to infect a bacterium, the phages produced in the host cell would have _____.

the protein and DNA of T4

The four bases contained in DNA are _____

adenine, guanine, cytosine, thymine

Which of the following describes a complete nucleotide?

a nitrogenous base, a sugar, and a phosphate group

Which of the following techniques was most helpful to Watson and Crick in determining the structure of DNA

X-ray crystallography

Chargaff found that for DNA _____.

the ratio of A to T is close to 1:1 and the ratio of G to C is close to 1:1

One strand of a DNA molecule has the base sequence ATAGGT. The complementary base sequence on the other strand of DNA will be _____.

TATCCA

The two sugar-phosphate strands of a DNA molecule are joined to each other through _____

hydrogen bonds between nucleotide bases

Who is generally credited with discovering that the DNA molecule is constructed as a double helix?

Watson and Crick

Which one of the following accurately reflects complementary base pairing in the DNA molecule?

guanine-cytosine

Which one of the following is true about double-stranded DNA?

The strands run in opposite directions.

The information in DNA is contained in _____

the sequence of nucleotides along the length of one strand of the DNA molecule

Which of the following statements is true for the Watson-Crick model for DNA?

The purines (double rings) base-pair with the pyrimidines (single rings).

The statement that each new molecule of DNA contains one parental and one newly synthesized strand of DNA refers to _____.

a model of DNA replication

During the replication of DNA molecules, _____.

both strands of a molecule act as templates

Two new strands of DNA molecules grow as bases are added by the enzyme ____

DNA polymerase

The role of DNA polymerases in DNA replication is to ___

attach free nucleotides to the new strand

attach free nucleotides to the new strand

DNA ligase

Monomers for the synthesis of DNA are called _____.

nucleotides

One strand of DNA has the following sequence of nucleotides: 3′-ATTCGCTAT-5′. The base sequence on the other strand of DNA would be _____

5′-TAAGCGATA-3′

Which description of DNA replication is correct?

A polymerase constructs a new strand alongside each old one by pairing complementary nucleotides.

A gene is usually _____.

The information for making a polypeptide

Who of the following formulated the one gene-one enzyme hypothesis

Beadle and Tatum

During protein metabolism, the amino acid phenylalanine is changed to the amino acid tyrosine via the enzyme phenylalanine hydroxylase (PAH). Tyrosine is then used to make L-Dopa via a second enzyme. If Beadle and Tatum's one gene-one enzyme model holds true for this metabolic pathway, what is the result of a PAH mutation that alters its functionality?

an accumulation of phenylalanine and no production of tyrosine and L-Dopa

Which one of the following is only associated with RNA?

uracil

When messenger RNA (mRNA) is being transcribed, the RNA base _____ always pairs with the base _____ in DNA.

U ... A

The DNA code is CGT. What is the messenger RNA transcribed from this?

GCA

Genetic information is transferred from the nucleus to the cytoplasm of eukaryotic cells in the form of _____

nucleic acids

A particular _____ carry the information for making a specific polypeptide, but _____ can be used to make any polypeptide.

gene and mRNA ... a ribosome and tRNA

There are _____ nucleotide bases "read" together on the mRNA to designate each amino acid. This unit is called a _____

three ... codon

Which of the following statements is true?

Each amino acid in a polypeptide is coded for by three bases in the DNA.

There are six different codons signaling for the placement of the amino acid leucine in a protein. Because of this, we say that the code is _____.

REDUNDANT

During the transcription of a given portion of a DNA molecule, _____.

mRNA is synthesized on only one of the chains

One strand of a DNA molecule has the following sequence: 3′-AGTACAAACTATCCACCGTC-5′. In order for transcription to occur in that strand, there would have to be a specific recognition sequence, called a(n) _____, to the left of the DNA sequence

promoter

As a cell carried out its day-to-day activities, the nucleotides GAT were paired with the nucleotides CUA. This pairing occurred _____

during transcription

A terminator in mRNA synthesis is a(n) _____.

specific nucleotide sequence in DNA that signals a stop

Which one of the following catalyzes the linkage between nucleotides to form RNA?

RNA polymerase

What is the proper order of the following events in the expression of a eukaryotic gene?

transcription, RNA processing, translation

A cell biologist found that two different proteins with largely different structures were translated from two different mRNAs. These mRNAs, however, were transcribed from the same gene in the cell nucleus. Which mechanism below could best account for this?

Exons from the same gene could be spliced in different ways to make different mRNAs.

Usually, in eukaryotic genes _____

both introns and exons are transcribed, but the RNA transcribed from introns does not leave the nucleus

Which of the following statements correctly describes mRNA processing in eukaryotes?

Introns are cut out, and the resulting exons are spliced together.

A base-substitution mutation in a germ cell line is likely to have no effect on phenotype if the substitution ____

occurs in an intron

In a eukaryotic cell, transcription takes place _____

in the nucleus

The function of tRNA during protein synthesis is to ____

deliver amino acids to their proper site during protein synthesis

The nucleotide sequence of a DNA codon is GTA. A messenger RNA molecule with a complementary codon is transcribed from the DNA. In the process of protein synthesis, a tRNA pairs with the mRNA codon. What is the nucleotide sequence of the tRNA anticodon?

GUA

The bonds that hold tRNA molecules in the correct three-dimensional shape are _____

hydrogen bonds

During translation in a eukaryotic cell, _____.

polypeptides are synthesized at ribosomes, according to instructions carried by mRNA

Which of the following processes takes place in the cytoplasm?

translation

During translation, amino acid chain elongation occurs until _____

the ribosome encounters a "stop" codon

A virus infects a cell and randomly inserts many short segments of DNA containing a stop codon throughout the organism's chromosomes. This will probably cause _____.

manufactured proteins to be short and defective

During the process of translation, _____ matches an mRNA codon with the proper amino acid

transfer RNA

Which brief outline of protein synthesis is correct?

Messenger RNA is made on a DNA template, and then amino-acid-bearing tRNAs line up on it through codon-anticodon pairing.

A geneticist found that a particular mutation had no effect on the polypeptide encoded by a gene. This mutation probably involved _____

substitution of one nucleotide

Imagine an error occurring during DNA replication in a cell, so that where there is supposed to be a T in one of the genes, there is instead a G. What effect will this have on the cell

One of the proteins might contain an incorrect amino acid.

Ultraviolet (UV) radiation is damaging because it _____

causes mutations in the DNA

Genetic mutations ____

can occur naturally

When a bacteriophage infects an E. coli cell, what part of the phage enters the bacterial cytoplasm?

only nucleic acid

The phage reproductive cycle that kills the bacterial host cell is known as a _____ cycle

lytic

A prophage is a(n) _____.

viral genetic material that has been incorporated into a bacterial cell's chromosome

In the lytic life cycle of phages, _____

the nucleic acid of the phage is all that enters the host cell

A microbiologist analyzed chemicals obtained from an enveloped RNA virus—similar to a mumps virus—that infects monkeys. He found that the viral envelope contained a protein characteristic of monkey cells. Which of the following is the most likely explanation?

The virus gets an envelope that contains host molecules when it leaves the host cell.

Which of these is classified as an emerging virus that can have a direct impact on human health?

Ebola

How do retroviruses such as HIV differ from other viruses?

They contain the enzyme reverse transcriptase.

Reverse transcription, carried out by retroviruses, is the process by which _____

RNA information is copied into DNA

Viroids are _____ molecules and are found in _____.

small circular RNA ... potatoes and other vegetables

Diseases such as diphtheria result from a process called lysogenic conversion where viral DNA is integrated into a bacterial chromosome, which allows particular toxins to be expressed. What mechanism of gene transfer is involved?

transduction

F plasmids _____.

contain the genes necessary to make a sex pilus

Please allow access to your computer’s microphone to use Voice Recording.

Having trouble? Click here for help.

We can’t access your microphone!

Click the icon above to update your browser permissions above and try again

Example:

Reload the page to try again!

Reload

Press Cmd-0 to reset your zoom

Press Ctrl-0 to reset your zoom

It looks like your browser might be zoomed in or out. Your browser needs to be zoomed to a normal size to record audio.

Please upgrade Flash or install Chrome
to use Voice Recording.

For more help, see our troubleshooting page.

Your microphone is muted

For help fixing this issue, see this FAQ.

Star this term

You can study starred terms together

NEW! Voice Recording

Create Set