Advertisement Upgrade to remove ads

MolGen500

A major difference between eukaryotes and prokaryotes is that eukaryotes have a nucleus, whereas prokaryotes do not. Discuss the impact of having a nucleus on the creation of mature mRNA.

More complex when transcription and translation are separated.

A coworker in your lab discovered a strain of E. coli that has a nonfunctional RNA polymerase. He felt sorry for the suffering E. coli and decided to add an RNA polymerase enzyme and gene from Drosophila to this mutant E. coli to allow the mutant strain to survive. You think that this is a foolish idea that will not work. Put together an argument as to why the addition of a Drosophila RNA polymerase could not possibly allow this mutant E. coli to survive.

E.Coli is a prokaryote and Drosophila is a eukaryote. Eukaryotes have a nucleus and separate transcription and translation.

What are the four nucleotides that make up RNA?

Adenine, guanine, cytosine, urasil

What happens to a chromosome that loses its centromere?

The chromosome is no longer able to attach to a spindle fiber. Since this is the case, they are usually lost when the cell splits.

What are the three classes of "functional" RNAs? Briefly describe the role of each class of functional RNA.

-Messenger: contains blueprint for protein synthesis
-Transfer: brings correct amino acid to the ribosome
-Ribosomal: makes ribosomes

How many primase molecules are needed on the leading strand? The lagging strand?

One for the leading strand, many for the lagging strand

In transcription, nucleotides are always added to the _____end of the elongating strand.

3'

An organism has a A + T content of 46%. What is the percentage for C?

100-46 then divide by 2

This form of DNA replication was eliminated during the Meselson-Stahl experiment because the original double-helix did not appear to be preserved during cell division.

Conservative Replication

This new strand of DNA has its 3' end oriented in the opposite direction as that in which the replication fork travels.

leading strand

MC: RNA differs from DNA in that it:

-U rather than T
-Usually single stranded
-Ribose sugars instead of deoxy

RNA polymerase must bind to a region of DNA called a(n) ____________ in order to begin transcription.

Promoter

The bonds that connect nucleotides in a strand are called _________bonds.

phosphodiester

Match: DNA primase

RNA primer synthesis

Match: theta replication

bidirectional circular replication

Eukaryotes have two of these per chromosome; prokaryotes have none.

telomeres

MC: In trying to determine whether DNA or protein is the genetic material, Hershey and Chase made use of which of the following facts?

DNA contains phosphorous

MC: In the DNA double helix,

a purine always pairs with a pyrimidine

MC: Which of the following best describes the addition of nucleotides to a growing DNA chain?

A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate

MC: Which diagram shows a nucleotide with a purine base?

double ring

MC: An mRNA has the stop codon 5'UAA3'. What tRNA anticodon will bind to it?

none

MC: Two eukaryotic proteins were found to be very similar except for one domain that was very different. Which of the following processes is most likely to have contributed to this phenomenon?

...

MC: Which of the following statements best describes the messenger RNA?

mRNA is the only type of RNA that carries DNA's protein building instructions

MC: An mRNA has the codon 5' UAC 3'. What tRNA anticodon will bind to it?

3'-AUG-5'

MC: What is a gene?

A sequence of DNA that encodes a protein

MC: After the peptide bond forms, what will happen?

tRNA B will be carrying the polypeptide and it will shift to the P site.

MC: Which of the sequences could form a hairpin?

TTACGGCGGTTCCGCCGGTG

MC: What chemical group is found at the 3' end of a DNA molecule?

hydroxyl group

MC: Translation of RNA into Protein takes place on which cellular organelle?

Ribosome

MC: What is the function of peptidyl transferase activity?

It forms peptide bonds

A number of scientists have become interested in telomerase as a drug target. Why would they be interested in telomerase? How might cancer drug therapies that target telomerase work?

Telomerase is an enzyme that prevents the telomeres of a chromosome from shortening. When the telomeres shorten, the cell eventually dies. In cancer cells, telomerase is constantly working so the cells never die.

What three general characteristics must the genetic material possess?

Contain complex information, replicate faithfully, encode the phenotype.

How does bacterial DNA differ from eukaryotic DNA?

introns

What does "proofreading" refer to with regard to DNA replication?

Looks for mismatched pairs

Hershey and chase labeled DNA using this radioactive atom.

phosphorous-32

This term describes the sequence of nucleotides which direct the formation of a new nucleic acid strand.

template strand

MC: Splicing of eukaryotic pre-mRNA involves ___ reactions and occurs in the ___ .

transesterification, nucleus

This organic subunit is the monomer from which nucleic acid is formed.

nucleotides

Write the anticodon, with correct polarity, of all tRNAs that will bind to the mRNA codon 5' UCG 3', considering wobble-base pairing rules.

3'-AGC-5'

This enzyme links two separate lengths of nucleic acid by creating a phosphodiester bond between them.

DNA ligase

MC: The poly(A) tails found in the 3' end of an mRNA are important for all the processes listed below except for ___ and ___.

Intron splicing and protein stability

The concept that genetic information passes from DNA to RNA to protein is called

Central Dogma

MC: A bacterial protein is encoded by the following mRNA sequence: AUGGUGCUCAUGCCCTAA.... The second methionine codon (AUG) in this mRNA sequence will

...

MC: The long term storage of genetic information in a cell occurs in the:

DNA

MC: Which statement is true regarding negative supercoiled DNA?

That negative supercoiled DNA is underrotated allows for easier strand separation during replication and transcription

MC: To translate a mRNA you require two other RNAs. These are

tRNA and rRNA

MC: Which is a characteristic of DNA sequences at the telomeres?

All of the above

MC: In prokaryotes, translation of an mRNA is coupled to

transcription

MC: The nitrogenous base that is found in RNA but not in DNA is

uracil

MC: DNA consists of repeating units of nucleotides. Which is NOT a component of a nucleotide?

a ribose sugar

MC: Before DNA was known to be the genetic material, scientists knew that genetic material must do or be all of the following, EXCEPT that

genetic material must be composed of many different units to account for the variability seen in nature.

MC: The role of tRNA is:

to act as transporters bringing amino acids to the site of protein synthesis

MC: All of the following are general purpose translation components and could be used in the translation of any gene, except for one. Which one?

Methionine

MC: In DNA replication, the lagging strand is

the strand which must be replicated in a direction away from the replication fork.

MC: A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon for the mRNA transcribed is

UCA

MC: Which of the following statements about the genetic code are TRUE?

Most amino acids are encoded by more than one codon

Why do eukaryotic chromosomes have multiple origins of replication, whereas prokaryotic chromosomes typically have only one origin?

Eukaryotes have a very large genome and it would take to long if there was only one origin. Prokaryotes have a smaller genome and can have only one.

Briefly discuss the evidence for the semi-conservative replication of DNA

Experiments by Matthew Meselson and Frank Stahl allowed E. coli to be labeled with 15N and 14N and then followed the density of the daughter cells using cesium chloride gradient centrifugation. They predicted that parental DNA molecules of one density which were allowed to replicate in another medium of a different density will show daughter DNA molecules of intermediate density because half will be old DNA and the other half will be new DNA. Their results proved that indeed half was old and other half was new indicating DNA of intermediate density.

Telomeres regulate the replication of the ends of chromosomes in eukaryotes. Why is this structure implicated in human aging?

Telomeres shorten as cells age and cells die when the telomeres are no longer present. When tested on mice, symptoms of aging were observed telomerase was not present. People with diseases of premature aging such as Werner syndrome and dyskeratosis congenital have shorter telomeres than healthy people.

Here is a list of eukaryotic RNA polymerases. Match them with what they transcribe. RNA Pol I; RNA Pol II; RNA Pol III.

Pol I: rRNA. Pol II: snRNA. Pol III: tRNA.

Two double-stranded fragments of DNA are exactly the same length. At 89°C, fragment A has completely denatured, which means that the two strands have separated. At that temperature, fragment B is still double-stranded. How might these fragments differ, to result in different denaturation temperatures?

The fragments may have a different composition of nucleotides. GC have three hydrogen bonds while AT have two hydrogen bonds.

What is the spliceosome?

The spliceosome is the RNA-protein complex that is responsible for intron-exon splicing in eukaryotes.

While actually a form of RNA polymerase, this enzyme lays down the initial nucleotides to set up a condition where DNA polymerase can then take over for replication.

primase

Whereas the nucleotide strand used for transcription is termed the____________ the nontranscribed strand is called the _____________ .

template, non-template strand

This method of replication preserves the covalent links on one strand of DNA but allows permanent separation of the "parental" double helix to form two templates.

semi-conservative replication

This Greek letter describes the shape of a bacterial chromosome mid-way through replication.

theta

Match: okazaki fragments

lagging strand

MC: Which of the following are role(s) of the 5' cap?

The cap plays a role in the removal of introns.
The cap protects the RNA from degradation.
The cap acts as a binding site for the ribosome.

MC: The 5' cap on an mRNA is important for all the processes listed below except for the ___ of an mRNA molecule.

The cap acts as a binding site for the ribosome, The cap plays a role in the removal of introns

Match: continuous synthesis

leading strand

Match: DNA gyrase

supercoil removal

MC: The TATA-binding protein (TBP) binds to the TATA box sequence in eukaryotic promoters. What is its function in transcriptional initiation?

It bends and partly unwinds DNA at a promoter.

MC: As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs?

The tRNA that was in the A site moves into the P site.

MC: In biology, most information flows through which sequence?

DNA to RNA to protein

MC: The anticodon on the tRNA molecule:

binds to the mRNA in a complementary fashion

MC: What is the function of eukaryotic RNA polymerase I?

ranscription of rRNA genes

MC: Which is true of the secondary structure of DNA?

Bases on complementary strands are held together by hydrogen bonds.

MC: What chemical group is found at the 5' end of a DNA molecule?

phosphate group

MC: What would Avery, Macleod, and McCarty have concluded if their results had been that only RNAse treatment of the heat-killed bacteria prevented transformation of genetic virulence?

that protein was the genetic material

MC: In eukaryotes, tRNAs are:

transcribed in the nucleus, function in the cytoplasm

MC: Telomeres_________the end of chromosomes

stabilize

MC: Which of the following features distinguishes RNA from DNA?

None of the above

MC: In what cellular compartment are introns removed from pre-mRNA to make mature mRNA?

Nucleus

What is semiconservative replication?

Each of the original nucleotide strands remains intact even though they are not combined in the same molecule.

Genetic material must replicate faithfully. Describe how the double-stranded structure of DNA gives it this property.

The double-stranded structure can be used as a template. Each strand is replicated so that the information is passed down correctly.

Explain at least two reasons why the following definition of a gene is inadequate: "A gene consists of DNA sequences that are transcribed into a single RNA molecule that encodes a single polypeptide."

This does not include all of the components of a gene such as transposable elements. This definition says what a gene does but not what a gene is.

Are Okazaki fragments formed on the leading strand during DNA replication? Explain your answer.

No they are formed on the lagging strand.

An organism has a G content of 30%. What is the percentage for A?

20%

MC: When this molecule is synthesized, both strands of a DNA molecule are used as a template.

DNA

This short piece of RNA is present only transiently in a newly-synthesized DNA molecule.

RNA primer

An organism has a T content of 28%. What is the percentage for C?

22%

In eukaryotes, RNA polymerase __ transcribes the genes that encode proteins.

...

In the Meselson-Stahl experiment, what hypothetical form of DNA replication results in the same DNA density distribution as the semiconservative method after the first cell division, but was not supported upon the second cell division?

dispersive replication

Match: DNA ligase

phosphodiester bonds at DNA nicks

Identify Purine or Pyrimidine: Adenine, uracil, guanine, thymine, cytosine.

Purines: A, G
Pyrimidines: T, C, U

Uracil contains________as sugar.

ribose

Match: rolling-circle replication

unidirectional replication

MC: Which of the following statements about a mammalian messenger RNA are FALSE?

None of the above

MC: Which one of the following statements regarding eukaryotic transcriptions is not true?

...

MC: Which of the following statements is not true concerning RNA and DNA?

RNA is more stable than DNA

MC: The spliceosome is a large enzyme that catalyzes removal of specific

introns in pre-mRNAs

MC: Which is not true of amino acids?

There are 20 of them required in the body

MC: The DNA replication enzyme that most closely resembles RNA polymerase is

...

MC: What secondary structures are formed when single-stranded DNA or RNA is inverted and complementary?

double helix

MC: Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes

excision of introns

MC: Which of the following statements is NOT true about enhancers?

...

Which different DNA polymerases are found in eukaryotic cells? What are their functions?

...

Kornberg used the phage PhiX174 to demonstrate DNA pol I was able to produce biologically active DNA in vitro. Describe the experimental methodology that he used to draw the conclusions that DNA pol I could produce biologically active DNA.

...

Name the three major modifications of mRNA of eukaryotes before it is transported to the cytoplasm. In addition, tell why each of the modifications is necessary.

...

How did the work of Hershey and Chase contribute to the model of DNA as the genetic material?

...

MC: The 3' untranslated region affects the ___ of mRNA and the ___ of the mRNA protein-coding sequence.

...

Short "bursts" of DNA synthesis that establish the lagging strand are called these.

okazaki fragments

MC: The ribosome is the primary site of:

...

MC: How do centromeres help control the cell cycle?

...

MC: The antiparallel nature of DNA refers to

...

MC: In each round of the elongation cycle of protein synthesis, a new _______ binds to the codon in the _______ site, then the peptide is transferred from the tRNA in the _______ site to the new aminoacyl-tRNA, and finally the entire _______ moves along the mRNA in a 5' to 3' direction.

...

MC: If a DNA molecule of 50 base pairs contains 15 cytosine bases (C), how many thymine bases will it have?

...

MC: When codons that code for the same amino acid differ in their ________, a single tRNA might bind both of them through wobble base pairing.

...

MC: DNA replication is semi-conservative in that

...

MC: Heterochromatin is characterized by all of the following, EXCEPT that it

contains genes that require high levels of transcription.

MC: Hairpins are formed in DNA as a result of

...

MC: Reverse transcriptase (from a retrovirus like HIV) generates

...

MC: The "RNA World" theory suggests that:

RNA was the genetic material in the first living cells.

MC: The chemical differences between DNA and RNA make RNA __________ stable than DNA and allow it to exist __________ in the life of most cells.

less; temporarily

MC: Which of the following traits exemplify plasmid DNA?

both A and B

MC: What is the function of the TATA binding protein?

...

MC: The packaging of DNA into a confined space is what level of DNA structure?

...

Please allow access to your computer’s microphone to use Voice Recording.

Having trouble? Click here for help.

We can’t access your microphone!

Click the icon above to update your browser permissions above and try again

Example:

Reload the page to try again!

Reload

Press Cmd-0 to reset your zoom

Press Ctrl-0 to reset your zoom

It looks like your browser might be zoomed in or out. Your browser needs to be zoomed to a normal size to record audio.

Please upgrade Flash or install Chrome
to use Voice Recording.

For more help, see our troubleshooting page.

Your microphone is muted

For help fixing this issue, see this FAQ.

Star this term

You can study starred terms together

NEW! Voice Recording

Create Set