NAME: ________________________

8th Grade DNA Test By Nikolas Angelopoulos Test

Question Types


Start With


Question Limit

of 18 available terms

8th Grade DNA Test By Nikolas Angelopoulos

6 Written Questions

6 Multiple Choice Questions

  1. Why should we study DNA?
  2. What does DNA contain the instructions for making?
  3. Where are genes found?
  4. A threadlike structure within the nucleus containing the genetic information that is passed from one generation of cells to the next.
  5. A pair of parallel helices intertwined about a common axis.
  6. The very weak bonds that hold DNA together.

6 True/False Questions

  1. ATCGTTATCAGATTATAGCAATAGTCTAAT?

          

  2. Adenine always pairs with Thymine, Cytosine always pairs with Guamine.Four bases.

          

  3. GuamineAdenine is madly in love with _______.

          

  4. DNAThymine is crazy for _______.

          

  5. A deoxyribose sugar molecule, a phosphate, and a base.Four bases.

          

  6. ThymineCytosine will only pair with _______.