Advertisement Upgrade to remove ads

T/F Messenger RNA is usually polycistronic in eukaryotes

False

T/F Heterogeneous nuclear RNA is a primary transcript in eukaryotes which is processed prior to involvement in translation

True

T/F Proteins are composed of strings of nucleotides connected together by 5'-3' phosphodiester bonds

False

T/F The secondary structure of a protein is dependent on polar interactions among the side chains of the amino acids

False

Alpha-Helix and Beta-Sheet

secondary protein structures

5' to 5' triphospate

Linkage found at the front-end of Pol II transcripts

intron

non-coding sequence

exon

coding sequence

polynucleotide phosphorylase

degradation of RNA

Which of the following two terms relates most closely to split genes?
a) 5'-cap, 3'-poly-A tail
b) introns, exons
c) elongation, termination
d) transcription, translation
e) heteroduplex, homoduplex

introns, exons

In 1964, Nirenberg and Leder used the triplet binding assay to determine specific codon assignments. A complex of the following components was trapped in the nitrocellulose filter?

charged tRNA, RNA triplet, and ribosome

The primary structure of a protein is determined by
a) the sequence of amino acids
b) hydrogen bonds formed between the components of the peptide linkage
c) a series of helical domains
d) pleated sheets
e) covalent bonds

the sequence of amino acids

An initiation factor can function to do the following during prokaryotic translation

enhances binding of formylmethionyl tRNA to the small subunit

When one speaks of a 5' cap, one is usually describing

addition of guanine to the 5' end of an mRNA

Nutritional mutations can be defined as

all strains which are not auxotrophic

What is the type of mutation shown?
wild type: met-trp-tyr-arg-gly-ser-pro-thr
mutant: met-trp

nonsense mutation

What is the type of mutation shown?
wild type: met-trp-tyr-arg-gly-ser-pro-thr
mutant: mert-trp-his-arg-gly-ser-pro-thr

missense mutation

What is the type of mutation shown?
wild type: met-trp-tyr-arg-gly-ser-pro-thr
mutant: met-cys-ile-val-val-val-gin-his

frameshift mutation

phosporylation of pRB is carried out by

CDK4/cyclin D

The transcription factor that controls expression of genes required for S-phase is

E2F

One difference between DNA and RNA polymerases is the ability of RNA polymerase to?

Initiate

Which of the following terms best describes catabolite repression associated with the E. coli lac operon?

positive control

When referring to attenuation in regulation of the tryptophan operon it would be safe to say that when there are high levels of tryptophan available to the organism . . .

transcriptional termination is likely

In the presence of lactose only, Predict the whether the structural genes of the operon are -constitutive-

I-O+Z+, I+OcZ+, I+OcZ+/F'O+

In the presence of lactose only, Predict the whether the structural genes of the operon are -permanently repressed-

IsO+Z+

In the presence of lactose only, Predict the whether the structural genes of the operon are -inducible-

I+O+Z+, I-O+Z+/F'I+

Which of the following is a positive regulator of the lac operon?
a) allolactose
b) beta-galactosidase
c) CAP-cAMP
d) all of the above

CAP-cAMP

Given the following sequence, predict the number of amino acids in the most probable polypeptide produced during translation in a prokaryotic cell?
ACCAUGGGGAGGAUGUUCAAUGAUGCUGGC
UGUUAUUAUUGAUAUUAACAUGUGUUGA

9

The correct order of for the assembly of the eukaryotic transcription complex is:

TFID,TFIIB,TFIIF,TFIIE,TFIIH

Examples of postranslational modification include
a) removal of signal sequences
b) phosphorylation and methylation
c) complexing with metal ions
d) addition of carbohydrates
e) all of the above

all of the above

Which of the following transcription factors binds the TATA sequence in eukaryotic promoters?

TFIID

Which of the following transcription factors positions RNA polymerase at prokaryotic promoters?

sigma factor

A mutation that results in a switch from a purine-pyrimidine base pair to a pyrimidine-purine base pair is a ______ mutation

transversion

Which of the following are characteristic of polycistronic RNAs

encodes two or more polypeptides

The term peptidyltransferase relates to

peptide bond formation during protein synthesis

Considering the structure of double-stranded DNA, what kinds of bonds link the nitrogenous bases on the on the complementary strands?

hydrogen

The two major components of the Tobacco mosaic virus are?

RNA and protein

Which histone protein attaches to DNA strands between nucleosomes

H1

Chromatin in eukaryotes is organized into repeating interaction with protein octamers called nucleosomes. Nucleosomes are composed of

histones

A nonhistone protein found in chromatin?

HMG

Eukaryotic chromosomes contain two general domains that relate to the degrees of condensation. These two regions are

separated by large stretches of repetitive DNA

The correct order of activity in replication

Helicase, SSB, primase, Pol III, Pol I, ligase

DNA polymerase catalyzes the formation of a bond between the

3'OH group of one nucleotide and the 5' phosphate of the next

Which of the following enzymes initiates chain synthesis on a template during replication?

primase

DNA synthesis in eukaryotes is

semi-conservative

Actually synthesizes RNA not DNA

primase

Contains an RNA molecule which is required to finction

Telomerase

Prevents reassociation of the DNA helix

SSB

Opens the double helix for replication machinery

helicase

Elongation of a DNA chain

DNA Pol III

The basic structure of a nucleotide includes the following components

Base, sugar, phosphates

The core nucleosome consists of which of the following?

2xH2A, 2xH2B,2xH3,2xH4

What about RNA polymerase is not true?

RNA normally transcribes both strands of DNA during the expression of a gene

What is a mechanism that allows a single gene to encode more than one polypeptide?

Alternative RNA splicing

If the sequence of an RNA molecule is 5'-GGCAUCGACG-3', what is the sequence of the template strand of DNA?

3'-CCGTAGCTGC-5'

During gene expression, which molecule carries the information that encodes polypeptides?

mRNA

If the sequence of a nontemplate strand of DNA is 5'-ACCGCATCCGAGTCAC-3' what is the sequence of the primary product of transcription?

5'-ACCGCAUCCGAGUCAC-3'

The DNA enzyme that most closely resembles RNA polymerase is

primase

When this molecule is synthesized, both strands of DNA are used as a template

DNA only

This molecule is synthesized using triphosphate nucleotides as a substrate for a polymerase enzyme that forms phosphodiester bonds

both DNA and RNA

This molecule is synthesized using nucleotides containing the bases A G C U

RNA only

This molecule is made of nucleotides joined by phosphodiester bonds that connect the 2'-OH to the 5'-phosphate

neither RNA or DNA

Unwinds the double helix

helicase

Prevents reassociation of complementary bases

SSB protein

Is DNA dependent RNA polymerase

Primase

Is DNA dependent DNA polymerase

Polymerase I

Is the polymerase involved in DNA repair

Polymerase I

Is the major elongation factor

Polymerase III

Has a 5'-3' exonuclease function

Polymerase I

Forms phosphodiester bonds between free 3'-OH of a polynucleotide to free 5' monophosphate end of a polynucleotide

Ligase

Which of the following is not true for all E. coli DNA polymerases?

They posses 5'-3' exonuclease activity

Which ability is not associated with DNA polymerases?

Ability to initiate DNA from scratch without a primer

The activity of which enzyme or protein would be needed latest in DNA synthesis?

DNA ligase

Which statement about the genetic code is not true?

Each species of organisms has its own unique genetic code

Please allow access to your computer’s microphone to use Voice Recording.

Having trouble? Click here for help.

We can’t access your microphone!

Click the icon above to update your browser permissions above and try again

Example:

Reload the page to try again!

Reload

Press Cmd-0 to reset your zoom

Press Ctrl-0 to reset your zoom

It looks like your browser might be zoomed in or out. Your browser needs to be zoomed to a normal size to record audio.

Please upgrade Flash or install Chrome
to use Voice Recording.

For more help, see our troubleshooting page.

Your microphone is muted

For help fixing this issue, see this FAQ.

Star this term

You can study starred terms together

NEW! Voice Recording

Create Set