molgen mod 2 final

Created by columbuspunk 

Upgrade to
remove ads

34 terms · module 2 final questions

name at least four structural predictions made by watson/crick DNA model?

• 2 polynucleotide chains coiled around a
central axis, forming right-handed helix
• The 2 chains are anti-parallel: 5'-->3'
runs in opposite directions on each
strand
• The bases lay flat, perpendicular to the
axis, stacked on one another 3.4
Angstroms apart
• The nitrogenous bases of opposite
chains are paired as a result of
hydrogen bonds
• In the chain, there are major grooves
alternating with minor grooves
• The double helix is 20 Angstroms in
diameter
• Each complete turn of the helix is 34
Angstroms

Briefly discuss the evidence for the semi-conservative replication of DNA determined by in vitro experiments in the bacteria E coli

Experiments by Matthew Meselson and Frank Stahl allowed E. coli to be labeled with 15N and 14N and then followed the density of the daughter cells using cesium chloride gradient centrifugation. They predicted that parental DNA molecules of one density which were allowed to replicate in another medium of a different density will show daughter DNA molecules of intermediate density because half will be old DNA and the other half will be new DNA. Their results proved that indeed half was old and other half was new indicating DNA of intermediate density.
The primase of E. coli, DnaG protein, cannot synthesize primers by itself, but rather it is
part of much larger complex called the primosome. The primosome acts repeatedly during
lagging strand synthesis, finding a primer-binding site on the SSB-coated single-stranded
template strand and synthesizing a primer. Identification of the components of the primosome
was aided by the convenient model system of in vitro synthesis of φX174 DNA. φX174 is a
single-stranded bacteriophage; the DNA found in the virus is termed the plus strand. After
infection of E. coli, this plus strand is converted to a double-stranded replicative form (Figure
5.24 A). The conversion of single-stranded phage DNA to duplex DNA occurs by the synthesis
of several Okazaki fragments, and hence it is a good model for discontinuous synthesis on the
lagging strand. This reaction can be carried out in vitro, which allowed the biochemical
dissection of the various steps in primosome assembly and movement.

What are the three classes of "functional" RNAs? Briefly describe the role of each class of functional RNA.

Answer: tRNA (brings the correct amino acid to the mRNA during translation); rRNA (major component of ribosomes); snRNA [helps process RNA transcripts (especially, helps remove introns)].

What experimental methods led Avery, McCarthy, and Macleod to determine that DNA was the "transforming material" in their classic experiments?

The purification procedure consisted of first killing the bacteria with heat and extracting the saline-soluble components. Next, the protein was precipitated out using chloroform and the polysaccharide capsules were hydrolyzed with an enzyme. An immunological precipitation caused by type-specific antibodies was used to verify the complete destruction of the capsules. Then, the active portion was precipitated out by alcohol fractionation, resulting in fibrous strands that could be removed with a stirring rod.The Avery-MacLeod-McCarty experiment was an experimental demonstration, reported in 1944 by Oswald Avery, Colin MacLeod, and Maclyn McCarty, that DNA is the substance that causes bacterial transformation.

Assume the following experiment in neurospora, where B,F,K, and S are suspected precursors in the M pathway. The data below show the growth behavior of mutants from $ complementations groups. + indicates growth; - indicates no growth.

Comp. Group I: growth on substances F and M containing minimal medium
Comp. Group II: growth on substances M containing minimal medium
Comp. Group III: growth on substances B, F and M containing minimal medium
Comp. Group IV: growth on substances B, F,K and M containing minimal medium

In what order do the proteins encoded by the genes of comp. groups I to IV act in this pathway?

IV III I II
K B F M

Below are a list of terms, each term relating to replication of chromosomes. Describe the role (relationship) of each in (to) chromosome replication.

A. Okakzaki Fragments
B. Lagging strand
C. Bidirectional

A. Okakzaki Fragments - formed on the lagging strand only. When the lagging strand is being replicated on the original strand, the 5' to 3' pattern must be used, thus a small discontinuity occurs and the Okazaki fragment forms.
B. Lagging strand- occurs in DNA replication during the fractional split and move in the opposite direction of the leading strand. the lagging strand also attaches to the okazaki fragments.
C. Bidirectional- a classsification of circular replication that occurs after the DNA splits for replication.

Describe the direction of information flow in living systems. Use appropriate, scientific terms in your description.

In biology, most information flows through DNA to RNA to protein.

An organism has a G content of 17%. What is the Percentage for A?

33

Polytene chromosome puffs are examples of what type of chromatin?

euchromatin

Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat (which breaks hydrogen bonds)?
Indicate the reason (or reasons) for your choice.
A:
GTATTAGAACATCTC
CATAATCTTGTAGAG
B:
TGAGCGTTCCAGCAG
ACTCGCAAGGTCGTC
Mark the correct boxes below:


DNA molecule A
DNA molecule B
DNA molecule A has a lower A-T content
DNA molecule B has a higher G-C content
DNA molecule A has a higher G-C content.
DNA molecule A has a higher A-T content

DNA molecule B
DNA molecule B has a higher G-C content
DNA molecule A has a higher A-T content

The bonds that connect nucleotides in a strand are called _________bonds.

Phosphodiester

Uracil contains ________ as sugar.

Ribose

Supercoiling caused by unwinding of the dsDNA molecule is relieved by what enzyme?

DNA gyrase

RNA polymerase must bind to a region of DNA called a(n) ____________ in order to begin transcription.

promoter

Write the anticodon, with correct polarity, of all tRNAs that will bind to the mRNA codon 5'UCG 3', considering wobble-base pairing rules.

3' AGC 5'

How many nucleotides would be expected for a gene coding for a protein with 300 amino acids?

900

Which is a characteristic of DNA sequences at the telomeres?
Question options:
a) One strand protrudes beyond the other, creating some single-stranded DNA at the end.
b) all of the above
c) They consist of cytosine and adenine nucleotides
d) The consist of repeated sequences

b all of them

Which is true of the secondary structure of DNA?
Question options:

a Cytosine pairs with adenine.
b Nucleotide bases are on the outside of the DNA molecule.
c Bases on complementary strands are held together by hydrogen bonds.
d Sugar-phosphate groups are on the inside of the DNA molecule.
e Thymine pairs with guanine

Bases on complementary strands are held together by hydrogen bonds.

To translate a mRNA you require two other RNAs. These are
Question options:

-tRNA and mRNA.

-tRNA and miRNA.

-tRNA and rRNA.

-rRNA and siRNA.

tRNA and rRNA.

As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs?
Question options:
a) The tRNA that was in the A site departs from the ribosome via a tunnel.
b) The tRNA that was in the P site moves into the A site.
c) The tRNA that was in the A site moves to the E site and is released.
d) The tRNA that was in the A site moves into the P site.

The tRNA that was in the A site moves into the P site.

The long term storage of genetic information in a cell occurs in the ______

DNA

DNA replication is semi-conservative in that
Question options:
a) The two strands of the original helix are not conserved, but the base sequence in the DNA is preserved.
b) DNA replication can only follow the replication fork on the leading strand.
c) The base sequence of a DNA a molecule is conserved, with very high fidelity, in DNA replication.
d) The two stands of the original helix are conserved, but they become part of separate progeny DNAs.

The two stands of the original helix are conserved, but they become part of separate progeny DNAs.

Which circle shows a phosphodiester bond?
Question options:

circle a

circle b

circle c

circle d

circle a

Which of the sequences could form a hairpin?
Question options:
ATTATTGGCGCTAACGCCAATTTT

CGCCAAAAAATCGCCCCCCAATTA

GCCGCCGCCGCCCCATTATTATTAT

TTCAATAATCGCTAATAACTGA

ATTATTTCGTACCCCCAATTTT

ATTATTGGCGCTAACGCCAATTTT

The packaging of DNA into a confined space is what level of DNA structure?
Question options:
a) primary
b) tertiary
c) quaternary
d) secondary

b) tertiary

Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be thymine?
Question options:
a) 31
b) 24
c) 12
d) 38

c) 12

Which of the following traits exemplify plasmid DNA?
A) It often carries genes beneficial to its bacterial host.
B) It replicates independently of the genomic DNA.
C)It is always larger than the genomic DNA.
D)Both A and B, above
E)Both B and C, above

Both B and C, above

When considering the initiation of transcription, one often finds consensus sequences located in the region of the DNA where RNA polymerase(s) bind. Which are common consensus sequences?

a.GGTTC, TTAT
b.TTTTAAAA, GGGGCCCC
c.any trinucleotide repeat
d.CAAT, TATA
e.satellite DNAs

d.CAAT, TATA

In addition to highly repetitive and unique DNA sequences, a third category of DNA sequences exists. What is it called, and what types of elements are involved?


a. composite DNA, telomeres and heterochromatin
b. dominant DNA, euchromatin and heterochromatin
c. permissive DNA, centromeres and heterochromatin
d. moderately repetitive DNA, SINEs, LINEs, and VNTRs
e. multiple gene family DNA, hemoglobin and 5.0S RNA

d. moderately repetitive DNA, SINEs, LINEs, and VNTRs

Translation is directly dependent on all of the following associations except _______.
a. complementary base pairing between mRNA and rRNA
b. complementary base pairing between mRNA and tRNA
c. association of the 30S and the 50S ribosomal subunits
d. complementary base pairing between mRNA and DNA

d. complementary base pairing between mRNA and DNA

By the experimentation using the neurospora fungus, Beadle and tatum were able to propose the far-reaching hypothesis that:

the role of a specific gene is to produce a specific enzyme.

A short segment of an mRNA molecule is shown below. the polypeptide it codes for is also shown:
5'-AUGGUGCUGAAG : methionine-valine-leucine-lysine
A mutation in the DNA occurs so that the fourth base (counting from the 5 end) in the messenger RNA now reads A rather than G. What sequence of peptides will the mRNA now code for? (You do not need a copy of the genetic code to answer the question.)

methionine-methionine-leucine-lysine

What is the initiator triplet in both prokaryotes and eukaryotes? What amino acid is recruited by this triplet?
a.UAA, no amino acid called in
b.UAA or UGA, arginine
c.AUG, arginine
d.UAA, methionine
e.AUG, methionine

e. AUG, methionine

the primary structure of a protein is determined by

the sequence of amino acids.

Please allow access to your computer’s microphone to use Voice Recording.

Having trouble? Click here for help.

We can’t access your microphone!

Click the icon above to update your browser permissions above and try again

Example:

Reload the page to try again!

Reload

Press Cmd-0 to reset your zoom

Press Ctrl-0 to reset your zoom

It looks like your browser might be zoomed in or out. Your browser needs to be zoomed to a normal size to record audio.

Please upgrade Flash or install Chrome
to use Voice Recording.

For more help, see our troubleshooting page.

Your microphone is muted

For help fixing this issue, see this FAQ.

Star this term

You can study starred terms together

NEW! Voice Recording

Create Set