 | Term | Definition |
| |
Relationship between area and biodiversity |
The greater the area, the higher the biodiversity |
| |
Relationship between latitude/elevation and diversity |
The greater the latitude/elevation, the lower the biodiversity |
| |
Relationship between regional diversity and diversity of a subset of that region |
The greater the regional diversity, the greater the diversity fo the subset |
| |
Relationship between evolutionary time and biodiversity |
The greater the amount of time elapsed, the greater the biodiversity (barring catastrophic extinctions) |
| |
Relationship between species diversity and functional diversity |
The higher the species diversity, the higher the functional diversity |
| |
Supernova |
exploding star |
| |
nebula |
cloud of cosmic dust and gas |
| |
Planetesimal accretion |
accretion of small bodies through gravity into planets |
| |
Order of the ages |
Precambrian, paleozoic, mesozoic, cenozoic |
| |
Moisture regime |
wet windward sides, arid downward sides |
| |
Temperature regime |
Higher elevation, cooler temperatures |
| |
Processes influencing biodiversity: relationship between spatial and temporal scale |
The smaller the scale, the more rapid the processes |
| |
Functional diversity: categories |
Producers, consumers (detritivores, herbivores) predators, parasites, parasitoids, carrion eaters |
| |
Disease |
negative effect of a parasite on its host |
| |
Parasite |
organism that lives in or on another organism and has a negative effect on the host |
| |
Pathogen |
Cellular/subcellular parasite |
| |
Virulence |
degree of damage cuased by the parasite |
| |
Disease example |
Sarcoptes scabiei causes mange on red fox; caused sharp population decline |
| |
Hutchinson's niche concept |
range of environmental conditions in which a species is able to survive and reproduce (predominates in contemporary work on species diversity) |
| |
Elton's niche concept |
ecological role of a species in the community where it occurs (valuable in analysis of trophic relations) |
| |
Limits to tolerance |
Flooding, drought, fressing, air pollutants, metallic ions, introduced pest or pathogen |
| |
Example of niche concept |
Flood tolerance of oak species has strong influence of tree distribution in river flood plains; roots need oxygen, but flooded soils become anaerobic because decomposers use up oxygen before it can diffuse through the floodwaters |
| |
Example of invasive aquatic species |
typically, rooted plants and phytoplankton provide carbon energy for lake ecosystem; but zebra mussels invade and shunt large amounts of carbon to the bottom of the lake (mussel feces) so it is not available to be used as energy; transported on undersides of boats |
| |
Reefs make uninhabitale waters into rich and diverse habitats by: |
symbiosis with microscopic algae lets them draw on solar energy in nutrient-poor waters; create anchor and shelter for other organisms. algae colonize firm CO3 surfaces, herbivores graze algae, predators feed on herbivores. |
| |
Guilds among reef biota |
Builders, bafflers, bioeroders, binders, dwellers |
| |
Builders |
corals; interlocking skeletons make up framework of the reef |
| |
Bafflers |
trap sediment and keep it inside the reef |
| |
Bioeroders |
drill into the solid framework of the reef or chew its structure |
| |
Binders |
calcareous algae, some sponges; hold together loose material by growing around it and keep it on the reef |
| |
Dwellers |
live in and around and on the reef |
| |
Reef control of oceanographic processes |
wave breaker |
| |
nebula to solar system |
nebula begins to condense; protostar forms out of gas and planetesimals form out of dust, nebula flattens into pancake; gravity converted to heat, most heat at centre and protosun lights up and becomes star around 10X10^6K by fusion; dust is vaporized, gases close to star blown away; cooling occurs, nebula clears, vapour recondenses, planetesimal accretion leaves only star and planets |
| |
growing the Earth |
through planetesimal accretion; not tranquil!; earth bombarded by millions of smaller bodies; this and gravity heated earth, partial/total melting of Earth; magma ocean created, denser Fe-rich material settled to centre; melting drove off any H or He pimordial atmosphere |
| |
Crust |
cold rock plates floating on mantle, 40 km deep; surface too hot and unstable for liquid water to exist |
| |
Mantle |
liquid rock, 40-2900 km deep |
| |
Outer core |
liquid iron, 2900-5000 km deep |
| |
inner core |
solid iron, 5000 km deep to centre |
| |
frost line |
planetesimals that condense close to the sun are rocky (Si, Al, Fe-rich) and those that condensed far from the sun are icy (gas and ice rich) |
| |
Planetary atmosphere mechanism: cloud |
atmosphere drawn to planet from nebulous cloud out of which everything came |
| |
Planetary atmosphere mechanism: decompose |
Elements that made up planet decomposed into gases released atmosphere |
| |
Planetary atmosphere mechanism: comets |
Comets hit planet and brought molecules with them |
| |
Planetary atmosphere mechanism: volcanoes |
volcanoes erupted and made an atmospere from gases inside planet |
| |
giant impact 4.5 Ga |
impact with mars-sized body; ejected material that condensed into a ring and then into the Moon |
| |
moon formation |
initially hot, covered by magma ocean, but small body cooled rapidly and is now biologically/geologically lifeless |
| |
Bombardment of the earth |
significant mechanism in earth's evolution; rapid drop in bombardment between 4.4 and 3.8 Ga; both asteroidal/meteoritical and cometary bodies; many impacts had enough energy to vapourize oceans, create steam atmosphere; provided volatile and depleted Earth with the volatile materials that became atmospheres, oceans, organisms |
| |
origin of earth's atmosphere |
outgassing and comet impacts; proportion of contributions unknown |
| |
volcanic gases |
H2O, CO2, SO2, H2S, HCl, N2, NO2; come from the melting of earth's crust |
| |
igneous |
fire-formed; cooling from liquid; extrusive and intrusive |
| |
sedimentary |
formed from chemical precipitates or fragments of earlier formed rocks; most of them accumulated in water |
| |
metamorphic |
formed by application of heat and pressure to either igneous or sedimentary rocks |
| |
absolute dating |
radiometric dating of igneous rocks using carbon isotopes |
| |
relative dating |
relationships between rocks; cross-cutting or superposition |
| |
radiometric dating concept |
mineral grains trap some radioactive parent element as well as some daughter element when they first form; by comparing the proportion of parent to daughter with the proportion in the atmosphere today, we can figure out how old osmething is |
| |
Earth sea floors |
very young (<160 Ma); much younger than most continental rocks and moon rocks |
| |
plate formation |
hot rising magma pushes plates apart at mid-ocean ridges |
| |
plate destruction |
subduction; one plate underneath another, melts into magma ocean |
| |
rock record: evidence of water |
ripples, mud cracks, sole marks from underside of stream bed; we can tell the difference between rocks made of wind deposits and water deposits, and also which way is up |
| |
half-life pairs |
some have longer halflives (rubidium 87, 48.8 Ga) and shorter halflives (carbon-14 5730 yrs) |
| |
zircon grains |
really tough, some survive erosion and chemical decomposition and become part of later rocks; acasta gneiss in nunavut contain zircons dated at 4.03 Ga |
| |
sedimentary rocks are hard to date because |
new minerals formed are difficult to separate from grains; common minerals in sedimentary rocks contain too little of long-lived radioactive elements; clay minerals continue to exchange ions with water during sedimentary burial |
| |
incomplete sedimentary rock record |
sed. rocks may lie on top of folded rocks or erally steep rocks; unconformity indicates that rocks are missing from a significant time interval during which no rocks were laid down |
| |
deposition + tilting + removal = |
angula unconformity; so to tell which way was younger or up, look at graded beds created by water flow |
| |
relative dating method: fossils |
only fossils from short-lived, widespread organisms are useful |
| |
rocks: cross-cutting and intrusiev relationships |
particularly valuable because location of igneous rocks can tell us whether they are older or younger relative to sedimentary rocks; provides for absolute ages of sedimentary rocks |
| |
earliest sedimentary rock |
isua gneiss 3.8 Ga; carbon isotope proportions suggest photosynthesis |
| |
free oxygen:uraninite and pyrite conglomerates |
UO2 and FeS2 break down in the presence of free oxygen; not found later than 1.8 Ga |
| |
free oxygen: banded iron formations |
Hematite and chert/magnetite/siderite stripes; layers rich in iron oxides alternate with silica layers; |
| |
BIF formation |
fe2+ ions from surface weathering of oxygen-rich mineral/rocks on land + O2 from cyanobacteria in surface waters = hematite |
| |
red beds |
sandstones where quartz grains are thinly coated with iron oxide; rare before 2 ga, since then more common; require v. little free O2 |
| |
stromatolites |
oldest ancient bacteria preserved in chert 3.5 Ga |
| |
earth 3.8 to 3.5 Ga |
no significant free oxygen, CO2-rich, shorter days (min 15 hours), Fe deposition in seawater; but ocean composition fairly similar, temperature range of water similar, simple life forms changing atmosphere |
| |
Essential attributes of life |
Bounded, organized structure with consistent, non-random composition; requiring steady inputs of energy; able to store and transmit information within/across generations |
| |
Origin of the earth date |
~4.5 Ga |
| |
Origin of stromatolites date |
~3.5 Ga |
| |
Gunflint fossils date |
2.1 Ga |
| |
First eukaryotes date |
1.8 Ga |
| |
End of Precambrian era date |
0.57 Ga |
| |
Prokaryotes |
Earliest life form; ancient lineages, high extant diversity, important ecological roles; critical in biogeochemical cycles, N and S especially; archaeans responsible for most methane entering atmosphere |
| |
Elements of life |
CHNOP; then S, K, Ca, Mg, Fe and Na; then some other metals |
| |
Necessity of bioenergetics in cell composition |
Concentration of many elements is different in living organisms than in the earth’s crust; requires energy input to create concentration gradient |
| |
Bioenergetics definition |
The getting of energy required to build and repair its own ever-failing structures |
| |
Coupled redox rxns |
Chemical basis of bioenergetic processes |
| |
Essential aspects of bioenergetics |
Energy stored in chemical bonds; chemicals can be broken up and reassembled, transferring energy; some energy lost as heat at each step in rxn; stepwise transfers prevail in rxns; almost all rxns require catalysis by enzymes |
| |
Classification of bioenergetic metabolisms |
Source of energy, source of carbon, source of reductant |
| |
Phototrophy |
Photons |
| |
Chemotrophy |
Chemical bonds |
| |
Autotrophy |
CO2 |
| |
Heterotrophy |
Organic molecules |
| |
Lithotrophy |
Inorganic molecules |
| |
Organotrophy |
Organic molecule |
| |
Extremophiles |
Crazy bacteria living near geothermal vent; chemolithotrophic |
| |
Two sites of dna storage in prokaryotes |
Circular chromosome in nucleoid, plasmids in cytosol |
| |
DNA to RNA |
Transcription |
| |
RNA to protein |
Translation |
| |
Ribosome structure |
Similar throughout all three domains; bacteria, archaea, eucaryota |
| |
Reproduction in prokaryotes |
Replication of circular chromosome and fissioning of the cell |
| |
Microevolution |
Among individuals within populations of a species |
| |
Macroevolution |
Diversification of lineages through speciation |
| |
Evidence of evolutionary change |
Selection, present biodiversity, fossil record, molecular phylogeny |
| |
Theory of natural selection |
Heritable variation in traits influencing survival (ego reproduction) exists; therefore some individuals contribute more offspring to the next generation than others (differential survival and reproduction); heritable traits of these successful individuals become increasingly more abundant in the population over time; ergo avg. characteristics of the population change over time as the population evolves |
| |
Example of selection pressure |
Antibiotic resistance |
| |
Mutations |
environmentally induced changes in DNA sequences |
| |
Genetic recombination |
Biologically mediated combining of genetic elements from different individual genomes |
| |
Recombination methods in prokaryotes |
Transfer by viral vectors; transfer of free DNA; transfer of plasmids; conjugation (tube thing, lateral gene transfer); no recombination in fission! |
| |
Conjugation |
Plasmid-mediated gene transfer; when one cell recognizes another cell that doesn’t contain a certain plasmid, it can trigger the formation of a conjugation tube to exchange genetic material. Because plasmids can be integrated into the circular genome and also excised from it, large potential for lateral gene transfer among prokaryotes |
| |
Aerobic photosynthesis date |
2.2 Ga (free oxygen in atmosphere required) |
| |
Fermentation date |
3.5 Ga |
| |
Aerobic respiration date |
1.2 Ga |
| |
How could an ancient prokaryote detect its position around a black smoker? |
Evolve pigments that can sense the long-wave radiation emitted by the vent; origin of phototrophy; if it began to colonize shallower water near sunlight, chlorophyll might evolve |
| |
Multicellular organisms date |
0.57 Ga |
| |
Eukaryotes |
DNA within nucleus; cytoskeleton; protein filaments in cell membrane; complex organelles; organelles with their own DNA |
| |
Eukaryote ancestors, DNA evidence |
Dna sequence data from genes in nucleus suggest they are more closely related to archaea, but mtDNA is more closely related to bacteria |
| |
Chimeric model of eukaryote |
Eukaryotes are cobbled together from bits and pieces of other organisms; symbiotic relationships; endocytosis |
| |
Asexual reproduction |
Organisms in the next generation are genetically identical to current generation |
| |
Sexual reproduction |
Recombination of information in the next generation, non-identical to current |
| |
Gene |
Self-replicating dna unit that occupies a specific location on a chromosome and determines a particular characteristic in an organism |
| |
Chromosome |
One long molecule of DNA |
| |
Genetic variation in meiosis |
Reassortment, crossing-over, |
| |
Advantages of sexual reproduction |
More opportunities for diploid organisms to take advantage of beneficial mutations or to control/remove the effect of possibly harmful mutations (redundancy, two chromosomes so if one is defective, is okay); creates mechanism for much more variation in every generation, ergo more material for evolution |
| |
Evolution of life: key points |
Various mechanisms at cellular/molecular level creating genotype variation; process at pop. level (nat. selection) for selecting genotypes; physical properties creating environmental heterogeneity on earth, merging & separating populations |
| |
Assessing descent with phenotypes |
Phenotypes, fossil record; looksee, compare; problems: enviro influence on phenotypes, ontogenetic changes, insufficient data, living and fossil; lack of universal traits |
| |
Chance of finding a fossil |
Dying in one piece, fossilized, undisturbed, exposed, found, recognized; small! |
| |
Assessing descent with molecular traits |
Complete record of genome; no env/ontogenetic effects; potential for universal traits; BUT need sophisticated technology, inferring patterns of change in gtacgtagcggctgctagtaaatatcttttctcgactga isn’t really intuitive; back mutation is possible, complicates analysis; selection may be operating |
| |
Causes of rise in eukaryote diversity 1.2 Ga |
Bigger genome, sexual reproduction, increased structural complexity, ozone layer protects from UV |
| |
Origin of Multicellular life; colonial hypothesis |
Dividing cells do not separate after division; mutation in cell membranes/walls; allows for evolution of separate functions for individual cells |
| |
Pikaia |
Big early step on the road to humans; ancestor of chordates, vertebrates |
| |
Cambrian ESPLOSION |
Huge diversification, from ediacarans to early Cambrian animals; 570 Ma to 540 Ma; all modern body plans established in >25 million yrs; changes since then are just variations on those established plans |
| |
Cambrian explosion – biological factors |
Increase in genetic complexity; increase in structural complexity; change in environment; chance in ecological relationships |
| |
Co-evolution |
Selection of favourable mutations in a biotic interaction between diff organisms (e.g. predatory behaviour, burrowing, digging, hard scales, jaws, spines, and so on) |
| |
Cambrian explosion – physical factors |
Shallow water marine environments; increase in number/complexity of these environments; increase in available nutrients; change in environment chemistry |
| |
Physical changes in late Precambrian |
Breakup of Rodinia; mountain forming; changing ocean currents; first of several major glaciations; O2 levels increase, CO2 drops |
| |
Tectonic plates |
Made of 40 km crust and 200 km rigid mantle |
| |
Evidence for plate tectonics |
Fossil distribution on Pangaea; direction of grooves carved by glaciers; polar wander; magnetite grains retain their magnetic orientation towards old positions of the magnetic north pole; magnetic anomalies, where compass points south → magnetic stripes in northern and southern hemisphere |
| |
Divergent plate margins |
New oceanic crust formed, or fault lines and weird landforms like horsts and grabens |
| |
Convergent plate margins |
Subduction; oceanic crust is recycled |
| |
Mantle hot spots |
Roughly cylindrical regions of hot upswelling mantle, creates volcanoes that are not associated with plate boundaries |
| |
Tectonic landforms produced by folding |
Synclines and anticlines |
| |
Plate boundaries |
Shearing: sliding past each other, crust is neither created nor subducted; crust pulled apart: steep faults; crust compressed: shallow faults |
| |
Folding |
Bending the crust |
| |
Faulting |
Fracturing the crust |
| |
Volcanism |
Molten rock forms structures on earth’s surface (volcanoes and lava flows) |
| |
Igneous intrusions |
Molten rock forms structures within the crust (plutons, batholiths, sills, dikes) |
| |
Tectonic movements affect life slowly |
Climate change as continents change latitudes; height/shape of mountains influences wind patterns; takes 10s of millions of yrs |
| |
Tectonic movements affect life quickly |
Bridges and barriers can form quickly; volcanoes, earthquakes that redirect erosive processes or change their rates, ocean basins can reconnect or separate within a million yrs |
| |
Fragmentation of rodinia |
Longer coastlines, increased shallow water habitats, increased volcanism at mid-ocean ridges → more CO2, sea level rise, flooding of continents |
| |
Relative ages of rodinia and pangea |
Rodinia – 750 Ma; pangea 540-250 Ma |
| |
Appalachians |
Ridges and folding reflect mid-paleozoic collision along continental margin; rivers don’t follow ridges today because erosion in late Paleozoic flattened relief so rivers could flow across mountain belt. Large areas have risen since, and rivers dug deeper and eroded more, accentuated relief |
| |
Paleozoic reassembly of supercontinent pangea |
Closure of an ocean, length of coastlines decrease, decreasing mid-ocean ridge volcanism |
| |
Mesozoic fragmentation of supercontinent pangea |
By 70 Ma continents were pretty much where they are today |
| |
Tools of landscape change |
Weathering ,erosion, transportation, deposition of rock and sediment |
| |
Earth surface |
Interface between forces driven by heat energy from inside the earth and energy from solar radiation |
| |
Weathering |
In situ weakening of intact rock; can be physical, chemical, and biological |
| |
Erosion |
Removal or entrainment of earth materials by an external force, e.g. running wate |
| |
Transport |
Material remains in motion |
| |
Deposition |
Occurs when energy available for transport decreases |
| |
Weathering; surface area |
Physical weathering fragments rocks, increases area exposed to physico-chemical attack |
| |
Regolith |
End product of weathering; rocky layer that overlies and protects unaltered bedrock |
| |
Mass wasting |
Regolith sliding downhill under gravity |
| |
Fluvial transport |
Sediment carried by running water |
| |
Sea coast transport |
Sediment transported by tides and wind waves along sea coasts |
| |
Suspended load |
Smaller particles remaining in water column held up by eddies |
| |
Bed load |
Heavier particles roll in contact with the bed; flow exerts enough friction to dislodge them |
| |
Drainage basin |
Ties runoff production and mountain wearing; moves sediment down to sea coasts |
| |
River long profile |
River slope and water velocity decrease going downriver |
| |
Pool –riffle pattern |
Creates contrasting habitats; in larger rivers results in alternating lateral bars, can grow into meanders |
| |
Meander pattern |
Concave (outer) bank eroded, convex (inner) bank deposited; meander neck cutoffs can create oxbow lakes when bends become too tight |
| |
Meander belt floodplains in lowland valleys |
Variety of interconnected habitats; diverse and complex habitat; floodwaters annually supply minerals and nutrients to the mosaic |
| |
Final destination: sediment |
Deposited mostly on continental shelf |
| |
Wave energy |
Can either erode (storms; backwash more energetic than swash) or deposit (swash more energetic than backwash) sediments |
| |
Long shore drift |
sand gets transported parallel to shore in direction of oblique waves |
| |
Beach groynes |
Trap sand, prevent beach erosion, stupid tourists |
| |
Coastal process effects |
Tend to simplify coastline and create lagoons and sheltered islands behind barrier islands or bars |
| |
Denudation |
Continental lowering |
| |
Denudation rates highest |
In high relief landscapes (steep valley sides) and drainage basis in climate zones with high precipitation and runoff |
| |
Davis model |
Recent uplift; then erosion continues, giving: landscape rejuvenation; youthful landscape; mature; old age; new peneplain at sea level |
| |
Alluvium |
a deposit of clay, silt, sand, and gravel left by flowing streams in a river valley or delta, typically producing fertile soil. |
| |
Davis model, as time increases |
Valleys become wide and rounded; river long profile becomes smooth and graded; discontinuities rapidly disappear |
| |
Davis model assumptions |
Short bursts of mountain building are separated by long periods of denudation, allowing for peneplains; however, mountain building forces can persist over many tens of millions of years, longer than a single peneplanation cycle; in that case, highest mountains are zones of fastest current uplift, not most recent; assumes that all rocks are equally erodable |
| |
Relative sea level |
Can trigger landscape rejuvenation (deep valleys, steep sides) |
| |
River terraces |
Remnants of previous, higher floodplain levels indicating rapid lowering of river long profile |
| |
Estuary |
River flow and sediments mix with sea water in a large coastal embayment |
| |
River delta |
Accumulating river sediments advance offshore |
| |
Sea level rise and fall |
Triggers regarding of river long profile |
| |
Davis model best reflects |
Humid temperate geopmorphic processes |
| |
Glaciation periods |
Several; about 7 |
| |
Glacier |
Mass of ice formed by accumulation and crystallization of snow and moving/flowing under the influence of their own mass and gravity |
| |
Glacier formation |
More snow falls in winter than melts in summer |
| |
Glacier classification |
Ice sheets, ice caps, cirque, valley glaciers |
| |
Glacier zones |
Accumulation, ablation; brittle, ductile |
| |
Glacial erosion |
Abrasion, plucking/quarrying |
| |
Depositional landforms associated with ice sheets |
Till (dumped by ice) and stratified drift (dumped by meltwater) |
| |
Drumlins |
Formed under glacier where debris load exceeds capacity of glacier to transport sediment; asymmetrical hills |
| |
Late Precambrian state of affairs |
O2-rich atmosphere, well-developed and rapidly diversifying biota, land still lifeless |
| |
Origin and diversification onto land |
Freshwater → desiccation tolerance → colonization of land → terrestrial biota |
| |
Single biggest challenge of land dwelling |
Desiccation tolerance; plants can dry and metabolically reactive once wet; animals cannot |
| |
Water management |
Cuticle and stomata to reduce/regulate water loss, hydroids to conduct water, rhizoids to take up water |
| |
Earliest erect land plants |
Tracheophytes, 410-390 Ma |
| |
Land adaptations |
Structural support; dessication; waste management; gas exchange; thermoregulation |
Share on Facebook
Share on MySpace