How can we help?

You can also find more resources in our Help Center.

65 terms

Biology exam 3

Ogden UVU
STUDY
PLAY
1. Marfan syndrome is the result of inheriting a single allele. Individuals with Marfan syndrome are tall and long-limbed, and have both cardiovascular and eye defects. The inheritance of Marfan syndrome is an example of ______.
**pleiotropy

gene linkage
2. An individual with (naturally) curly hair and an individual with (naturally) straight hair mate; all of their offspring have (naturally) wavy hair. If an individual with wavy hair mates with an individual with straight hair, what is the probability that their child will have curly hair?
50%
100%
75%
**0%
25%
3. Attached earlobes are recessive to free earlobes. What is the probability of having a child with attached earlobes when an individual with attached earlobes mates with an individual heterozygous for free earlobes?
0%
75%
100%
**50%
25%
4. Which of these crosses will only produce heterozygous offspring?
AA × Aa
aa × aa
**AA × aa
Aa × Aa
Aa × aa
5. Assume that having three nostrils is inherited as a sex-linked trait on the Y chromosome. A man with three nostrils has a daughter who has a son with a man who has only two nostrils. What is the probability that the three-nostriled man's grandson has three nostrils?
50%
**0%
100%
75%
25%
6. According to Mendel's law of segregation, ______.
**gametes have one copy of each allele
Mendel was
the father of genetics, inheritance, and statistics. Also came up with independent assortment. Used math the solve genetics.
A true-breeding plant that produces yellow seeds is crossed with a true-breeding plant that produces green seeds. The seeds of all of the offspring are yellow. Why?
**The yellow allele is dominant to the green allele.
In humans, the presence or absence of dimples is a trait controlled by a single gene. What is the genotype of an individual who is heterozygous for dimples?
dd
dimples
DI
DD
**Dd
How many amino acids are common to all living systems?
**20
Evidence for the spiral nature of DNA came from ______.
**X-ray crystallography studies
The name of the woman who (Watson and Crick got their idea of the structure of DNA from, was named
Roslin Franklin (she the one who studied these x-ray crystals mentioned above)
The expressed (coding) regions of eukaryotic genes are called ______.
**exons
A mutation within a gene that will insert a premature stop codon in mRNA would ______.
**result in a shortened polypeptide chain
HIV (human immunodeficiency virus) must use its own ______ to reproduce.
**reverse transcriptase

RIBOSOMES
The absence of a terminator in transcription will result in ______.
**the production of a longer RNA molecule
The RNA that is translated into a polypeptide is ______ RNA.
**messenger
Translation converts the information stored in ______ to ______.
**RNA . . . a polypeptide
What is a difference between embryonic and adult stem cells?
**Embryonic stem cells are undifferentiated; adult stem cells are partially differentiated.
Possible uses of reproductive cloning include ______.
the production of potentially valuable drugs
the production of organs in pigs for transplant into humans
the production of genetically identical animals for experimentation
**all of the above.
restocking populations of endangered animals
At one point, you were just an undifferentiated, single cell. You are now made of many cells; some of these cells function as liver cells, some as muscle cells, some as red blood cells, while others play different roles. What name is given to the process that is responsible for this?
**cellular differentiation
Which of these lifestyle choices will increase cancer risk?
**a diet high in animal fat
How can a single RNA transcript be translated into different polypeptides?
**There is more than one way to splice an RNA transcript.
Gel electrophoresis separates DNA fragments on the basis of differences in their ______.
**length
A DNA fragment with a sticky end that reads -ATTCG will bind with another DNA fragment with a sticky end that reads ______.
**TAAGC-
"Sticky ends" are produced as a result of the action of ______.
**a restriction enzyme
Which of these is a genetically modified organism?
**an organism carrying a gene that was acquired by artificial means
the first organism in which a particular mutation has appeared
an organism carrying genes from two different parents
an organism that gestated in an artificial womb
a cloned organism carrying two different alleles
"Sticky ends" are ______.
**single-stranded ends of fragments of double-stranded DNA
While working with cultured mayfly cells, Dr. Ogden unknowingly treated the cells with a mutagen that although rare, causes deletion or insertion of individual bases in DNA. Subsequently, He isolated and cultured a single cell from this group and noticed that the progeny of this cell were not producing a certain protein and this was having an effect on their viability (even though mayflies are so cool). The mutation would be most harmful to the cells if it resulted in ______.
**a single nucleotide insertion near the start of the coding sequence
Given the template DNA strand TACACCTCCCTACTACTCCCGGGATC, and that the string of bases CTACTACT represents an intron region. What is the mRNA processed transcript?
**AUGUGGAGGGGGCCCUAG
Given the template DNA strand TACACCTCCCTACTACTCCCGGGATC, and that the string of bases CTACTACT represents an intron region. How many codons are in this mRNA?
**6
In humans, the inheritance of ______ is best explained as being polygenic.
*height
Red-green color blindness is inherited as a sex-linked recessive trait. The gene is found on the X chromosome. How can a man with normal color vision father a daughter who is red-green color-blind?
He can't (unless there is a mutation)
The best definition of a true-breeding plant is one that ______.
self-fertilizes to produce offspring identical to the parent
What is the key to the recognition of codominance?
The phenotype of the heterozygote falls between the phenotypes of the homozygotes.
What is the best explanation for a BbCc × bbcc cross producing offspring in a 5:5:1:1 phenotypic ratio?
linked genes
Round seeds (R) are dominant to wrinkled seeds (r), and yellow seeds (Y) are dominant to green seeds (y). What is the expected phenotypic ratio of a cross between an RrYy and anrryy individual?
1:1:1:1
Transcription is the ______.
manufacture of a strand of RNA complementary to a strand of DNA
The correct sequence of events occurring during transcription is ______.
initiation, elongation, termination
Where is translation accomplished?
ribosomes
Introns are ______?
noncoding DNA sequences
One of the most potent environmental carcinogens is ______.
UV radiation
Inheritance of certain genes increases the risk of getting certain cancers; thus, it can be said that ______.
predisposition to these cancers is inherited
Define Hypothesis
"proposed explanation" tentative explanation
Define Metabolism
the sum of all chemical reactions in an organism
Monomer-
-a simple compound whose molecules can join together to form polymers
-"one"
-For Example: the cars that make up a train would be the monomers
Polymer-
a naturally occurring or synthetic compound consisting of large molecules made up of a linked series of repeated simple monomers
"a chain of something"
For Example: a train
Meiosis-
(genetics) cell division that produces reproductive cells in sexually reproducing organisms
Mitosis-
cell division in which the nucleus divides into nuclei containing the same number of chromosomes
Mutation-
(genetics) any event that changes genetic structure
,(biology) an organism that has characteristics resulting from chromosomal alteration
Translation
(genetics) the process whereby genetic information coded in messenger RNA directs the formation of a specific protein at a ribosome in the cytoplasm
Transcription-
(genetics) the organic process whereby the DNA sequence in a gene is copied into mRNA
What is population density?
a measurement of population per unit area or unit volume
How would you find population density?
For Example: The crowd of people in the photo Dr. Ogden showed 1-take a small area 2- count how many people are in that area and estimate how many exist through multiplication of the rest of the sections
____ decides the protein functions
shape
The person/organism that had the most offspring is considered to be the ____
fittest or most fit organism
Asexual-
a type of reproduction involving only one parent that produces genetically identical offspring by budding or by the division of a single cell or the entire organism into two or more parts
Homology-
similarity in characteristics that results from common ancestry
Hydrogen Bond-
bond created by the weak attraction of a slightly positive hydrogen atom to a slightly negative portion of another molecule
Ionic Bond-
bond formed when one or more electrons are transferred from one atom to another
Covalent Bond-
A bond formed when atoms share one or more pairs of electrons
The guy that thought that traits were developed by actions
Lamark
Darwin
- came up with the theory of natural selection and common ancestry
- invented the use of drawing trees method to represent evolution
- known as "the man who walks with Henslow"
-thought that humans originated from Africa
The guy who was going to publish the book about natural selection independent of Darwin
Wallace
Henslow
Darwin's mentor at Christ College, botanist, tells Darwin about the HMS Beagle going to the Galapagos