141 terms

Module 3 Exam Study Guide

STUDY
PLAY

Terms in this set (...)

Describe, in order, the steps usually followed in producing recombinant DNA molecules in a plasmid vector
- isolation of DNA (foreign and plasmid)
- digestion of DNAs with an appropriate restriction endonuclease
- ligation of fragments
- transformation of host cells
Intron frequency varies considerably among eukaryotes. Provide a general comparison of intron frequencies in yeast and humans. What about intron size?
The entire yeast genome has only about 240 introns, whereas some single genes in humans contain over 100 introns. In general, smaller genomes have smaller intron size in addition to lower intron number.
In the genetic map of the human genome, one map unit is approximately 850,000 bp. For the genome of the eukaryotic yeast Saccharomyces cerevisiae, one map unit is approximately 3000 bp. What is a map unit, and why is it so different in these two different types of organisms?
A map unit is the amount of measured recombination between two linked points in a genome.

Because one map unit in humans is many more base pairs than in yeast, the amount of homologous recombination per DNA length must be lower in humans than in Saccharomyces cerevisiae.
Nucleic acid blotting is commonly used in molecular biology. Two types, Southern blots and northern blots, involve gel electrophoresis and a filter, which holds the nucleic acid. Briefly describe the procedure of "blotting" in this context and differentiate between Southern and northern blots.
In a Southern blot the DNA to be "probed" is cut with a restriction enzyme(s); then the fragments are separated by gel electrophoresis. Alkali treatment of the gel denatures the DNA, which is then "blotted" onto the filter (nylon or nitrocellulose). A labeled probe (RNA or DNA) is then hybridized to complementary fragments on the filter. In a northern blot, RNA is separated in the gel and "probed" with the labeled DNA.
Name and describe three different kinds of bacterial cloning vectors
1) plasmid: contain a multi-cloning site, origin of replication, and a selectable marker; can carry ~20-25Kb of foreign DNA

(2) phage: a virus containing the DNA of interest infects bacteria; is more efficient than plasmid transformation and can carry ~25Kb of foreign DNA

(3) cosmid: type of hybrid plasmid that contains plasmid sequences plus the COS sequences from phage for capsid packaging for phage transduction; cosmids form colonies, not plaques; can carry up to ~45Kb of foreign DNA

(4) bacterial artificial chromosome or BA: a vector based on the bacterial F-plasmid (fertility plasmid), making its introduction in bacteria more stable than plasmids; typical foreign DNA insert size is in the hundreds of Kb
Two genes that evolved from the same common ancestral gene, but are now found as homologs in different organisms are called:
orthologs
Typically, bacterial DNA contains_____ (more or less?) repetitive DNA than eukaryotic DNA.
less
A typical prokaryotic genome has:

A. 1 million base pairs of DNA, containing 1000 genes.
B. 1 million bps of DNA, containing a few hundred genes.
C. 1000 bps of DNA, containing a few hundred genes.
D. 1000 bps of DNA, containing a few thousand genes.
A. 1 million bps of DNA, containing 1000 genes.
List two especially useful characteristics of cloning vectors.

A. high copy number and antibiotic resistance gene(s)
B. virulence and lysogenicity
C. can integrate into host chromosome & cause a lytic cycle
D. nonautonomous replication and transposition
E. reverse transcriptase and ligase activities
A. high copy # and antibiotic resistance gene(s)
Of the DNA sequences below, which would probably be the harder to determine?
CGATATATATATATATACGAT
The Human Genome Project, which got under way in 1990, is an international effort to:

A. construct a physical map of the 3.3 billion base pairs in the human genome.
B. collect samples of cells from all parts of the world in order to preserve human genetic diversity.
C. collect plant seeds in order to reduce the impact of human activity on plant extinction.
D. clone deleterious genes from humans and study their mode of action.
E. clone beneficial genes from humans for eventual use in gene therapy
A. construct a physical map of the 3.3 billion base pairs in the human genome.
Nucleic acid blotting is widely used in recombinant DNA technology. In a Southern blot one generally:

A. hybridizes filter-bound DNA with a DNA probe.
B. hybridizes filter-bound RNA with a DNA probe.
C. examines amino acid substitutions w/ radioactive probes.
D. cleaves RNA with restriction endonucleases.
E. ligates DNA with DNA ligase.
A. hybridizes filter-bound DNA with a DNA probe.
In the context of molecular genetics, reverse translation refers to:
A. assembling a DNA sequence from an AA sequence.
B. assembling an RNA sequence from a DNA sequence.
C. translating in the 3' to 5' direction.
D. transcribing first, then translating.
E. making an amino acid sequence from a DNA sequence.
A. assembling a DNA sequence from an AA sequence.
Restriction endonucleases are especially useful if they generate "sticky" ends. What makes an end sticky?

A. single-stranded complementary tails
B. blunt ends
C. poly-A sequences
D. 5' cap
E. interference
A. single-stranded complementary tails
A ddNTP, used often in DNA sequencing, lacks a(n) ________ at the ________ and ________ carbons.

A. OH, 2', 3'
B. methyl, 2', 3'
C. carboxyl, 5', 3'
D. OH, 2', 5'
E. None of these are correct.
A. OH, 2', 3'
The human genome contains approximately 20,000 protein-coding genes, yet has the capacity to produce several hundred thousand gene products. What can account for the vast difference in gene number and product number?

A. It is estimated that 40 to 60 percent of human genes
produce more than one protein by alternative splicing.
B. There are more introns than exons.
C. There are more exons than introns.
D. Much of the DNA is in the form of trinucleotide repeats, thus allowing multiple start sites for different genes.
E. Every gene can be read in both directions, and each gene can have inversions and translocations.
A. It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing.
What is comparative genomics? How does its study contribute to our understanding of genetics?
Comparative genomics is a relatively new field involved in identifying similarities and differences in organization and gene content among the genomes of different organisms. Such studies are important for studying the genetic relatedness of species and for identifying gene families.
Explain why the greatest diversity of human SNPs is found among African people.
Humans are thought to have first evolved in Africa. This means that any distinct population of humans (however defined) arose from a subset of the African population that became geographically isolated. Thus, any SNPs in this population arose from precursors that were already present in the African population, and another branch of those ancestral SNPs' descendents is likely still extant in the African population. Basically, for any SNP "family" in a distinct human Population X, the African population probably has a SNP family very similar to that one, plus several others with no clear analogue in Population X.
Answer the following questions about standard PCR:

1) What enzyme is required for PCR? State the specific name of the enzyme, not just the type of enzyme.
2) Apart from the enzyme, what 3 DNA molecules are required (give the technical names by which they are called)? What must be true about the sequences of these molecules? Note that dNTPs are individual nucleotides, not DNA molecules.
3) Name the three basic steps of PCR and describe the molecular processes that occur in each. How is each step induced?
4) How does this system work to amplify DNA?
1) Taq polymerase (half credit for just "polymerase"). (Worth 25% of points)


2) 2 primers, 1 template, dNTPs. The primer sequences must be complementary to the ends of the sequence to be amplified. (25%)


3) Denaturation: Temperature is raised to ~94 C. Strands of DNA separate.
Annealing: The temperature is is lowered to 50-65 C. Primer strands anneal to the template strand.
Extension (elongation is also acceptable): The temperature is raised to ~72 C. Taq polymerase synthesizes a complementary DNA strand from dNTPs. (25%)


4) The amount of DNA is doubled in each reaction, so that after (for example) 30 cycles, it has increased by a factor of 2^30. (25%)
Describe the organization of the α-globin gene cluster in humans. Roughly how large is this cluster? How many genes are present? Briefly describe these genes.
The α-group spans more than 30 kb and contains three genes: zeta and two copies of the alpha gene. In addition, two nonfunctional pseudogenes are in the group. Most of the DNA in this region consists of intergenic spacer DNA.
What is a concise definition of proteomics?

A. the process of defining the complete set of proteins encoded by a genome
B. the harvesting of proteins from a cell to determine their economic value
C. the manipulation of amino acid sequences in proteins to alter their function
D. changing the terminal sequences of proteins to alter their function
E. the rational design of drugs based on protein structure
A. the process of defining the complete set of proteins encoded by a genome
Most of the bacterial genomes described in the text have fewer than

A. 10,000 genes
B. 5,000 base pairs
C. 500 genes
D. 10,000 base pairs
E. 50 genes
A. 10,000 genes
A BLAST search is done to:

A. find similar gene or protein sequences.
B. find the chromosomal location of a sequence.
C. predict 3D structure of a protein from its AA sequence.
D. find restriction sites and SNPs in a sequence.
E. determine the conditions in which a gene is expressed.
A. find similar gene or protein sequences.
Over the years, sophisticated plasmid vectors have been developed for use in recombinant DNA technology. Describe the useful features that have been introduced in these vectors.
small size to allow large inserts

high copy number

large numbers of unique restriction sites (polylinkers)

variety of selection schemes (pigmented colonies, antibiotic resistance)
Assume that one conducted a typical cloning experiment using pUC18, transformed an appropriate host bacterial strain (one carrying the lacZ complementing region), and plated the bacteria on an appropriate X-gal medium. Blue and white colonies appeared. Which of the two types of colonies, blue or white, would most likely contain the recombinant pUC18? Explain your answer.
the white colonies because of insertional inactivation of the lacZ component
The haploid human genome contains about 3 × 109 nucleotides. On average, how many DNA fragments would be produced if this DNA was digested with restriction enzyme PstI (a 6-base cutter)? RsaI (a 4-base cutter)? How often would an 8-base cutter cleave?
4 base cutter = (1/4)^4 = 1/256bp gets cut (3x10^9)/256 = 11,718,750 cuts

6 base cutter = (1/4)^6 = 2.44e-4 ~ 1/5000bp gets cut (3e9/5000) = 600,000 cuts

8 base cutter = (1/4)^8 = 1e-5 ~1/100,000 gets cut (3e9/100000) = 30,000 cuts
What are three key differences between a genomic and a cDNA library?
cDNA lib. represents only transcribed regions of the genome;

all genes equally represented in genomic library while cDNA library reflects the level of expression of a gene in a particular cell type or tissue ;

cDNA library contained only sequences found in the mature mRNA - introns are removed
As a model system, what are three of the advantages of the mouse as a model system?
Easy to grow

• Short generation time

• Produce abundant progeny

• Readily mutagenized and crossed. Mice have similar body plans and stages of development as humans

• Similar genome size and number of chromosomes to humans
The lungfish Protopterus aethiopicus has a genome 38 times larger than that of humans. Most of the DNA in this species is noncoding repetitive DNA. How could you create a library of clones that would let you compare just the genes in the lungfish to the genes in humans?
You could generate cDNA libraries and compare the transcribed regions of the genome.
List four applications of PCR technology. Do not describe what PCR does (well, you can if you want, but you won't get points for it). Instead, list activities or fields in which PCR is useful.
Any 4 of the below are acceptable (or others if it is a legitimate use of PCR)

Cell-free cloning

Identification of restriction enzyme variants

Screening for genetic disorders

Diagnostic screening for infectious organisms

Forensics

Paleobiology
Molecular biologists rely on many, often sophisticated, techniques to pursue their discipline. One may list ultracentrifugation, electron microscopy, X-ray diffraction, electrophoresis, and computer interfacing as fundamental. Model organisms provide the raw materials for study. List four "organisms" (or organismic groups) often used by molecular biologists and describe a major advantage of each group to the molecular biologist. We might consider these as "model organisms" of the molecular biologist.
Bacteriophage: relatively simple, short generation time. Bacteria: relatively simple, short generation time, simple growth requirements. Yeast: relatively simple for a eukaryote, short generation time, simple growth requirements. Drosophila: relatively simple to culture, extensive genetic and developmental information available, "giant" polytene (salivary gland) chromosomes.
Match each term with the best letter choice:

in situ hybridization

a. chromosome spread
b. protein
c. plasmid
d. centromere
e. multiple hosts
a. chromosome spread
What is recombinant DNA technology? What are the safety issues related to recombinant DNA technology?
Recombinant DNA technology refers to the creation of new combinations of DNA molecules that are not normally found in nature. Safety issues generally center around the creation and release (accidental or intentional) of genetically engineered organisms that are a threat to human health or animals and plants in the environment. Many organisms that are "genetically engineered" carry genes for antibiotic resistance.
Mario Capecchi, Sir Martin Evans, and Oliver Smithies recently won a Nobel Prize for gene targeting (gene knockouts) in mice. Describe the steps involved in creating a knockout mouse.
Embryonic stem (ES) cells heterozygous for a knockout mutation in a gene of interest (X) and homozygous for a marker gene (here, black coat color) are transplanted into the blastocoel cavity of 4.5-day embryos that are homozygous for an alternate marker (here, white coat color). The early embryos then are implanted into a pseudopregnant female. Some of the resulting progeny are chimeras, indicated by their black and white coats. Chimeric mice then are backcrossed to white mice; black progeny from this mating have ES-derived cells in their germ line. By isolating DNA from a small amount of tail tissue, it is possible to identify black mice heterozygous for the knockout allele. Intercrossing of these black mice produces individuals homozygous for the disrupted allele, that is, knockout mice.
Present a general definition for a multigene superfamily.
Multigene superfamilies share DNA sequence homology, and their gene products are functionally related. They are often (but not always) found together in a single location in a chromosome. They are believed to be derived from a common ancestral gene.
Match each term with the best letter choice:

Expression Vector

a. chromosome spread
b. protein
c. plasmid
d. centromere
e. multiple hosts
b. protein, c. plasmid
What is bioinformatics?

A. a technique using 3D images of genes in order to predict how and when they will be expressed
B. a method that uses very large national and international databases to access and work with sequence information
C. a software program available from NIH to design genes
D. a series of search programs that allow a student to identify who in the world is trying to sequence a given species
B. a method that uses very large national and international databases to access and work with sequence information
A bacterial polycistronic transcription unit is one that:

A. contains information for one protein product.
B. contains information for more than one protein product.
C. is capped at the 5'end and carries a poly-A tail at the 3'end.
D. is void of start (AUG) and termination (UAA, UGA, UAG) triplets.
E. none of these answers
B. contains information for more than one protein product.
PCR is:

A. necessary for efficient replication of cell's DNA in interphase
B. a technique for amplifying DNA sequences in vitro
C. one of the control elements of the cell cycle
D. None of the above
B. a technique for amplifying DNA sequences in vitro
Explain why the genetic map distance between two genes on the same chromosome may be inconsistent with the physical map distance. E.g., for three loci A, B, and C, on the same chromosome, explain why the genetic distance might be A-[20 centimorgans]-B-[20 cM]-C, while the physical distance might be A-[200 kilobases]-B-[100 kb]-C.
Different regions of the chromosome will be more prone to recombination than others.
Compare the transcriptome of an organism with the proteome. What is described by each? Which one will generally have more macromolecules, and why?
Transcriptome has all RNA transcripts, coding and non coding. Proteome only has the proteins that result from those transcripts. Some genes encode non-coding RNAs that are not translated into proteins.
A section of a genome is cut with three enzymes: A, B, and C. Cutting with A and B yields a 10-kb fragment. Cutting with B and C yields a 2-kb fragment. What is the expected result from a digest with A and C, if the C site lies in between the A and B sites?

A. A 12-kb fragment
B. An 8-kb fragment
C. An 8-kb and a 2-kb fragment
D. A 10-kb and a 2-kb fragment
E. A 10-kb, an 8-kb, and a 2-kb fragment
B. An 8-kb fragment
It is common to use ddNTPs (dideoxyribonucleoside triphosphates) in which of the following biochemical reactions?

A. Citric acid cycle
B. DNA sequencing
C. restriction digestion
D. electron transport
E. plasmolysis
B. DNA sequencing
Under ideal conditions, how many copies of all the sequences of the host genome should be represented in a genomic library? Why?
At least one should be represented. Typically, library construction includes a several-fold greater number of clones than necessary for one representative of each fragment in order to increase the likelihood of cloning difficult fragments and stochastic loss.
Describe one major difference in the organization or content of prokaryotic and eukaryotic genomes.
Eukaryotic genomes contain repetitive DNA that is largely absent in prokaryotic genomes.

-or-

Genes are more densely spaced in prokaryotes versus eukaryotes

-or-

prokaryotic genomes typically encode fewer genes than eukaryotic genomes

Other answers are acceptable, provided they are true and make sense.
nswer the following questions about standard PCR:
1) What enzyme is required for PCR? State the specific name of the enzyme, not just the type of enzyme.
2) Apart from the enzyme, what 3 DNA molecules are required (give the technical names by which they are called)? What must be true about the sequences of these molecules? Note that dNTPs are individual nucleotides, not DNA molecules.
3) Name the three basic steps of PCR and describe the molecular processes that occur in each. How is each step induced?
4) How does this system work to amplify DNA?
...
In general, the organization of genes in bacteria is different from that in eukaryotes. In E. coli, approximately 27 percent of all genes are organized into contiguous, functionally related units containing multiple genes under coordinate control that are transcribed as a single unit. Such contiguous gene families are called

A. transcriptomes
B. proteomes
C. contigs
D. operons
E. pseudogenes
D. operons
When two proteins show a 50 to 70 percent match in amino acid sequence, it is likely that

A. the two proteins have identical functions.
B. the two proteins have no common origin.
C. the two proteins share a common ancestry.
D. the two proteins have identical tertiary structures.
E. the primary structures may differ, but the secondary structures are identical.
C. the two proteins share a common ancestry.
Which technique would NOT be used to find a gene for a functional protein in a sequenced region of a genome?

A. Scan the region for ORFs.
B. See if an EST database contains sequences in the region.
C. See if a SNP database contains sequences in the region.
D. Scan the region for promoter sequences.
E. Scan the region for intron splice sites.
C. See if a SNP database contains sequences in the region.
Some vectors such as pUC18 and others of the pUC series contain a large number of restriction enzyme sites clustered in one region. What term is given to this advantageous arrangement of restriction sites?

A. palindrome
B. consensus sequence
C. multiple cloning site
D. β-galactosidase
E. complementation
C. multiple cloning site
Describe the three basic components of a typical plasmid cloning vector and the reason/use for those plasmid vector components.
A typical plasmid vector will have the following components:
-Polylinker: First, there will be a multiple cloning site OR polylinker that is "cut" with specific restriction enzymes. The same restriction enzyme can then be used to "cut" templated DNA. When the cut vector and template are mixed together the complementary single stranded regions will anneal to one another and this complementarity is covalently linked using DNA ligase. Once in the vector, the vector is transferred into a bacterial host, where is multiplied.
-Antibiotic resistance marker: The vector also contains antibiotic resistance genes so that when growing in the presence of antibiotic, only those bacteria with the vector will be able to grow.
-Selectable marker: Lastly, the vector will contain a selectable marker, eg. the lacZ gene. The polylinker is located within this gene, when a template is ligated within the lacZ gene it is made nonfunctional. In the presence of a colorimetric indicator, such as X-gal, which is broken down into a blue byproduct by lacZ, the presence of a template fragment in the plasmid vector is visualized by white bacterial colonies. These colonies can then be chosen for further analysis.
Crossing over is often reduced around centromeric regions of chromosomes. If you were trying to construct a genetic map of two linked marker loci in this region, what result might you obtain and why? How would the genetic map correspond to the physical map?
Genes mapped based on recombination will appear to be very close together in centromeric regions due to low rates of recombination. Distances between the same genes on the physical map may be much greater when compared to other regions of the chromosome.
You determine that you have only three copies left of an important DNA fragment, so you decide to amplify it. Using flanking primers, how many PCR cycles would you have to run to generate over one billion (109) copies of the fragment?
Accept anywhere from 28 to 30 cycles as a correct answer or the following equation

3 x (2^n) => than 1 billion)
Match each term with the best letter choice:

Shuttle Vector

a. chromosome spread
b. protein
c. plasmid
d. centromere
e. multiple hosts
c. plasmid
Mycoplasma are among the smallest and perhaps the simplest self-replicating prokaryotes known. M. genitalium contains a genome of 0.58 Mb. Approximately how many genes does this bacterium contain?

A. about 3000
B. 426,000
C. 12
D. 1200
E. between 400 and 550
E. between 400 and 550
If a restriction enzyme cuts a circular DNA into three fragments, how many restriction sites are there in the DNA?

A. two
B. three
C. four
D. six
E. five
B. three
Match the following terms with their definitions. Enter one number per box.

1. Closely related genes based on sequence and function.

2. Homologous genes of the same locus inherited from a common ancestor.

3. Genes related by gene duplication in the genome.

4. Conservation of the same groups of genes in the chromosomes of 2 or more species.
1. Homolog
2. Ortholog
3. Paralog
4. Synteny
Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the fragments contains the DNA piece of interest. This problem is solved by:

A. Knowing the isoelectric points of the piece in question.
B. Measuring the sizes of the bands on the gel
C. Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest
D. Identifying the molecular weights of the fragments in question
E. None of the above
C. Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest
There are different challenges that exist for sequencing prokaryotic and eukaryotic genomes. Which challenge is correctly paired with the type of genome to which it relates?

A. Prokaryotic: presence of plasmids
B. Prokaryotic: repetitive DNA
C. Eukaryotic: repetitive DNA
D. Eukaryotic: ESTs
E. Eukaryotic: circular DNA
C. Eukaryotic: repetitive DNA
The full-length (i.e., containing the entire protein-coding region) cDNA for a specific eukaryotic gene in humans is 1500 nucleotides long. You screen a pig genomic library with this cDNA and isolate two genomic clones of different lengths. Both clones are sequenced and found to be 1900 and 2100 nucleotides long from start codon to stop codon. Screening of genomic libraries of several other organisms reveals that all of them contain only one genomic clone -- pigs seem to be the exception to the rule here. What evolutionary events might have led to the presence of two genomic clones in pigs, and the discrepancies in their length compared to the cDNA probe? How is this representative of a general type of occurrence in molecular genetic evolution?
50% credit: There was likely a duplication of this gene in pigs.
25% credit: After duplication, the gene has diverged.
25% credit: Evolutionary divergence tends to follow gene duplications, as mutations in one gene are no longer selected against as strongly (the presence of a "back up" copy of the gene means the individual will generally have at least one functional copy of the gene product).

25% credit: Alternatively, humans may have lost one copy of this gene. However, this possibility should be ruled out by the fact that pigs seem to be unique in possessing two genomic copies.
Words such as did, mom, and pop have something in common with the fundamental tool of recombinant DNA technology. In the context of recombinant DNA technology, which term would be used to describe such words?

A. lysogenic
B. prototrophic
C. palindromic
D. conjugation
E. insertion
C. palindromic
What is the enzymatic function of restriction enzymes?

A. to add new nucleotides to the growing strand of DNA
B. to repair breaks in sugar-phosphate backbones
C. to cleave nucleic acids at specific sites
D. to join nucleotides during transcription
C. to cleave nucleic acids at specific sites
Restriction endonucleases are typically used to clone genes. What factors determine the sites at which these endonucleases will cleave DNA? What characteristics do these sites tend to have?
Each RE will cleave at a specific sequence. These sequences tend to be short (4-8 bp), and tend to be palindromic (e.g., GAATTC).
We have looked at the cloning experiments involved in producing Snuppy. Describe the specific technique that was used and how the results demonstrated that Snuppy was in fact a clone of the donor Afghan hound.
Microsatellite analysis was used to show that Snuppy was a clone. Microsatellite loci are highly variable loci that contain a large number of DNA repeats (eg. 2, 3, or 4 nulceotides in length) at the population level. However, an individual can only have 2 of these alleles at any one microsatellite locus. By comparing the alleles that Snuppy had at 8 different microsatellite loci with those alleles that the donor Afghan hound and the surrogate mother had, it was shown that Snuppy had exactly all of the same alleles as the Afghan hound, proving that Snuppy was a clone of the donor Afghan.
One of the primary reasons for generating a large number of clones in a eukaryotic genomic library is that

A. each cosmid replicates nonautomously.
B. lysogenic phages continue to integrate their DNA into the host chromosome, thus reducing the number of desired recombinant clones.
C. each vector can take up only a relatively small fraction of the eukaryotic DNA.
D. each ligation product is sequence specific.
E. the host range of the vector is limited.
C. each vector can take up only a relatively small fraction of the eukaryotic DNA.
Clones can be of a cell, an organism, or a molecule. What characteristic do they all have in common?

A. All are alternate forms of the ancestor
B. All require plasmid cloning techniques
C. All are derived from a single ancestor
D. All contain mutations
C. All are derived from a single ancestor
List the three basic components required for a bacterial cloning vector and briefly describe the purpose of each.
origin of replication for propagation in the host;

selectable marker like Amp resistance;

polylinker or unique restriction enzyme sites to facilitate cloning
Compared with eukaryotic chromosomes, bacterial chromosomes are:

A. large, mainly organized in monocistronic transcription units without introns.
B. small, mainly organized in monocistronic transcription units with introns.
C. large, mainly organized in polycistronic transcription units without introns.
D. small, with high gene density.
E. large, triple-helix, Z-DNA, organized in monocistronic units with introns.
D. small, with high gene density.
Which of the following are the important proteins needed for cloning a eukaryotic gene into a bacterial plasmid?

A. DNA polymerase
B. restriction enzymes specific for the target genes
C. DNA ligase
D. Both B and C
D. Both B and C
What do PCR, reverse transcription, and dideoxy DNA sequencing all have in common?

A. All produce RNA as a product.
B. All produce RNA as a product.
C. All produce lipid as a product.
D. All produce DNA chains as a product
D. All produce DNA chains as a product
The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the discovery of a bacterium called Thermus aquaticus in a hot spring inside Yellowstone National Park, Wyoming. This organism contains a heat-stable form of DNA polymerase known as Taq polymerase, which continues to function even after it has been heated to 95 degrees C. Why would such a heat-stable polymerase be beneficial in PCR?

A. Each cycle includes a "hot" saturation phase (95oC), which allows the primers to anneal to the target DNA.
B. Each cycle includes a "hot" denaturation phase (95oC), which serves to sterilize the culture.
C. Each cycle includes a "hot" denaturation phase (95oC), which activates the Taq polymerase.
D. Each cycle includes a "hot" denaturation phase (95oC), which separates the hydrogen bonds that hold the strands of the template DNA together.
E. More than one of these answers is correct.
D. Each cycle includes a "hot" denaturation phase (95oC), which separates the hydrogen bonds that hold the strands of the template DNA together.
What are Northern analyses used for? Describe the steps involved in performing a Northern analysis, and describe how levels of gene expression are determined.
Northern blots are used to detect/compare/study RNA in a sample.

Steps:

(1) RNA is extracted from tissue, cells etc.

(2) Gel electrophoresis separates RNA molecules based on size

(3) RNA is "blotted" (transferred) from the gel onto a membrane.

(4) RNA is fixed to the membrane and hybridized with a probe (probe is labeled radioactively or with enzymes for chemiluminesence)

(5) Visualization of RNA using X-ray film or phosphoimager screen.

RNA levels can be determined and quantified by the darkness of the bands in the image.
A human gene with a disease phenotype is going to be mapped by positional cloning. Which would be the most useful for this task?

A. Information about bacterial orthologs of the gene
B. An EST database of the human genome
C. Microarray data of tissues in which the gene is expressed
D. Data about the inheritance of SNP markers in families with the disease
E. Whole-genome-shotgun clones of the human genome
D. Data about the inheritance of SNP markers in families with the disease
The difference between a genetic screening experiment and a selection experiment is that a screening experiment involves ________, whereas a selection experiment creates conditions that ________ irrelevant organisms.

A. complementation analysis, enhance
B. temperature extremes, enhance
C. epistasis analysis, enhance
D. visual examination, eliminate
E. chemical removal, activate
D. visual examination, eliminate
The set of all proteins encoded by the genome is called the _______ .

A. genome
B. transcriptome
C. metabolome
D. proteome
E. pharmacogenome
F. glycome
D. proteome
For a physical map of a chromosome, distances are measured in units of

A. percent recombination.
B. RFLPs.
C. centiMorgans.
D. base pairs.
E. contigs
D. base pairs.
Which of the following enzymes is used to make complementary DNA (cDNA) from RNA?

A.DNAse
B. gene cloning
C. hydrogen sulfide
D. reverse transcriptase
E. isolation of stem cells from a lamb embryo and production of a zygotic equivalent
D. reverse transcriptase
Briefly discuss general trends relating to DNA content and gene number in major groups of organisms. How do eukaryotes and prokaryotes differ in regard to gene number and organization? As a general rule, what can be said about the genomes of more complex eukaryotes vs. less complex eukaryotes? If two species are very closely related, what can be said about the relative sizes of their genomes?
Eukaryotes contain more DNA in their genomes than bacteria and exhibit a wide variation of DNA amount among different groups. Evolutionary expansion has been accompanied by increased amounts of DNA, with more "complex" forms containing more DNA than less complex forms. Such change in DNA content is not universally accompanied by increases in gene number. Some closely related species may vary more than tenfold in their DNA content.
A set of overlapping DNA fragments that form a contiguous stretch of DNA is called a

A. chromosome
B. sequence
C. map
D. contig
E. clone
D. contig
Fluorescent Sanger dideoxy sequencing methods uses what method to discriminate between the 4 different nucleotides?

A. Centrifugation sedimentation gradient.
B. Fluorescently labeled dNTPs
C. Fluoresently labeled dATP.
D. Different fluorochromes attached to the four different ddNTPs.
D. Different fluorochromes attached to the four different ddNTPs.
Restriction endonucleases...

A. are used to randomly digest DNA molecules.
B. are human enzymes.
C. are all genetically engineered.
D. cut DNA at specific sequences
D. cut DNA at specific sequences
Assume that a plasmid (circular) is 3200 base pairs in length and has restriction sites at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion.

A. 400, 800, 1000 (2 of these)
B. 400, 1200, 1600
C. 300, 700, 2200
D. 700, 400, 1400, 2600
E. 300, 700, 1000, 1200
E. 300, 700, 1000, 1200
Compared with prokaryotic chromosomes, eukaryotic chromosomes are

A. large, mainly organized in monocistronic transcription units without introns.
B. small, mainly organized in monocistronic transcription units with introns.
C. large, mainly organized in polycistronic transcription units without introns.
D. small, mainly organized in polycistronic transcription units without introns.
E. large, linear, less densely packed with protein-coding genes, mainly organized in monocistronic units with introns.
E. large, linear, less densely packed with protein-coding genes, mainly organized in monocistronic units with introns.
Plasmids are important in biotechnology because they are


A. a vehicle for the insertion of foreign genes into bacteria
B. recognition sites on recombinant DNA strands
C. surfaces for protein synthesis in eukaryotic recombinants
D. surfaces for respiratory processes in bacteria
A. a vehicle for the insertion of foreign genes into bacteria
What is the purpose of a cDNA library?

A. To produce a library of all genomic DNA of an organism.
B. To produce a library of expressed genes.
C. To replicate the genomic DNA.
D. To produce a library of chloroplast genes.
B. To produce a library of expressed genes.
Match each term with the best letter choice:

ß-galactosidase

f. Taq polymerase
g. DNA quantification
h. protein/DNA interaction
i. lacZ
j. foreign DNA
k. mRNA
l. Agrobacterium tumefaciens
i. lacZ
What is meant by the term pseudogene?
Pseudogenes are nonfunctional versions of genes that resemble other gene sequences but that contain significant nucleotide substitutions, deletions, and duplications that prevent their expression. Pseudogenes are designated by the prefix (psi).
The first commercial production of what human enzyme led to the explosion of the biotechnology industry?

A. Polynucleotide Phosphorylase
B. Inuslin
C. Amylase
D. Lactose Dehydrogenase
B. Inuslin
This is the study of "genes in their entirety."
genomics
Archaea (formerly known as archaebacteria) is one of the three major divisions of living organisms; the other two are eubacteria and eukaryotes. Nanoarchaeum equitans is in the Archaea domain and has one of the smallest genomes known, about 0.5 Mb. How can an organism complete its life cycle with so little genetic material?
...
A map of the distribution of cloned genomic DNA from genomic clone libraries.
physical map
What is the function of dideoxynucleotides in Sanger DNA sequencing?

A. They act as primers for DNA polymerase.
B. They act as primers for reverse transcriptase.
C. They cut the sequenced DNA at specific sites.
D. They allow only the specific sequencing of the RNAs of a genome.
E. They stop synthesis at a specific site, so the base at that site can be determined.
E. They stop synthesis at a specific site, so the base at that site can be determined.
A PCR technique that fills in small gaps by using the end of a cloned sequence as a primer to amplify into adjacent uncloned fragments
primer walking
What is the name of the process by which bacterial colonies (cells) are transferred from one agar plate to another, maintaining the same spatial pattern?
replica plating
During gel electrophoresis, __ will migrate more rapidly than __.


a. cloning vectors
b. ethidium bromide
c. large DNA fragments
d. DNA size markers
e. small DNA fragments
e, c
One major difference between prokaryotic and eukaryotic genes is that eukaryotic genes can contain internal sequences, called ________, that get removed in the mature
introns
Which of the below are not steps in the production of genome sequence maps:

A. Read the sequence of individual piece of the genome.
B. Isolate whole chromosomes.
C. When sequences are obtained, assemble and organize the sequences in order.
D. Identify molecular markers on specific chromosomes.
E. All of these are steps you would use
...
A number of generalizations can be made about the organization of protein-coding genes in bacterial chromosomes. First, the gene density is very high, averaging about
One gene per kilobase pair of DNA
This term refers to the work undertaken by large teams of researchers who, through a concerted effort, clone and sequence the DNA of a particular organism
genome project
What might be a reasonable function of restriction endonucleases in a bacterium, distinct from their use by molecular biologists?
...
What is the purpose of the LacZ gene in a plasmid cloning vector?
...
Describe the relationship between introns (size and number) and organismic complexity in eukaryotes.
...
What two factors contribute significantly to the wide ranges of genome size among eukaryotes?
...
Name 2 methods that are used to produce mutations in a forward genetics approach
...
What appears to be the range of number of protein-coding genes per genome in eukaryotes?
...
What is meant by the term low gene density? Give an example of an organism with low gene density.
...
Assume that you have cut λ DNA with the restriction enzyme HindIII. You separate the fragments on an agarose gel and stain the DNA with ethidium bromide. You notice that the intensity of the stain is less in the bands that have migrated closer to the "+" pole. Give an explanation for this finding.
...
Of what advantage is it to have a polylinker region (multiple unique restriction sites) embedded in the lacZ component in the pUC series of plasmids?
...
When propagating a clone in the lambda phage, would you have more immediate success if the phage entered the lysogenic or the lytic cycle?
lytic cycle
A gene construct that indicates when transcription occurs because the protein is easily identified (often GUS or GFP)
reporter gene
The dog (Canis familiaris) genome has recently been sequenced. About what percent of the dog's genes are shared with humans?
75%
Match each term with the best letter choice:

real-time PCR

f. Taq polymerase
g. DNA quantification
h. protein/DNA interaction
i. lacZ
j. foreign DNA
k. mRNA
l. Agrobacterium tumefaciens
g. DNA quantification
Another word for a "DNA chip" (microscopic spots of oligonucleotides bound to glass that can be fluorescently labelled to identify levels of expression).
microarray
Match each term with the best letter choice:

YAC

a. chromosome spread
b. protein
c. plasmid
d. centromere
e. multiple hosts
c. plasmid
Why are telomeres and centromeres particularly difficult to sequence?
They consist of highly repetitive DNA, and so strand slippage issues can confuse the determination of a consensus sequence.
Present an overview of the gene organization in large-genome plants. What general level of gene density do plant genomes normally exhibit? What is the composition of the non-gene portions of the DNA?
...
Match each term with the best letter choice:

transgene

f. Taq polymerase
g. DNA quantification
h. protein/DNA interaction
i. lacZ
j. foreign DNA
k. mRNA
l. Agrobacterium tumefaciens
j. foreign DNA
A linear DNA fragment is cut with a restriction enzyme to yield two fragments. There is/are __ site(s) for this enzyme in this fragment
1
A _______________ family is a group of evolutionarily related genes that arose through repeated evolution of an ancestral gene.
multigene
What is the function of restriction endonucleases in bacteria?

A. They provide a defense mechanism against infection by viruses.
B. They allow bacteria to genetically recombine with other bacteria.
C. They serve no function.
D. They allow bacteria to engineer new DNA fragments
A. They provide a defense mechanism against infection by viruses. Restriction endonucleases recognize and degrade viral DNA, thus preventing viral infections.
Restriction endonucleases cut DNA at specific recognition sequences and then bond two strands covalently with the same "sticky ends."
False. Restriction endonucleases cut DNA at specific sequences, but DNA ligase must be used to bond two strands covalently with the same "sticky ends."
BamHI cuts the sequence 5′ G|GATCC 3′. Which of the following sequences would not be recognized by this enzyme?

A. 3′ CCTAGGATC 5′
B. 5′ AGGATCCGTA 3′
C. 5′ AGCGGATCC 3′
D. 3′ TCTTAAG 5′
D. 3′ TCTTAAG 5′. This sequence does not contain the BamHI recognition site.
Phage λ can carry larger DNA fragments than plasmids.
True. Phage vectors can carry DNA fragments of about 20 kb, whereas plasmids can only carry DNA of less than 15 kb.
Which of the following elements is not found in a plasmid?

A. Polylinker
B. lacZ gene
C. Antibiotic resistance
D. Lambda arms
D. Lambda arms. Lambda arms are regions that flank the inserted foreign DNA in phage λ vectors.
A DNA fragment is introduced into the lacZ gene of a plasmid, which also contains a tetracycline resistance gene. What is the appearance of bacteria transformed with this plasmid if they are spread on plates containing tetracycline and Xgal?

A. Blue colonies that are resistant to tetracycline
B. White colonies that are resistant to tetracycline
C. Blue colonies that are sensitive to tetracycline
D. White colonies that are sensitive to tetracycline
B. White colonies that are resistant to tetracycline. The presence of blue colonies means that the plasmid taken up by these bacteria is recombinant, since the lacZ gene was disrupted.
Which of the following molecules is not required for a PCR reaction?

A. Ligase
B. DNTPs
C. Primer
D. DNA
A. Ligase. Ligase is not required for a PCR reaction. The enzyme used during PCR is a thermostable DNA polymerase.
The thermostability of Taq polymerase is required during the annealing phase of PCR.
False. The annealing phase takes place at the lowest temperature of PCR. Taq polymerase is derived from bacteria that live in hot springs, so the enzyme is thermostable, meaning that its enzymatic properties can withstand the high temperatures needed for denaturation.
What is the purpose of raising the temperature to 90-95°C at the beginning of each cycle of PCR?

A. To attach the primer
B. To extend the primer
C. To renature two single DNA strands
D. To separate the double‑stranded DNA
D. To separate the double‑stranded DNA. The temperature is raised to denature the double‑stranded DNA molecule into single strands.
The products of restriction digestion can be visualized by gel electrophoresis, which separates fragments based on their size.
True. Restriction digestion produces fragments of DNA, and the sizes of these fragments can be determined by gel electrophoresis using standard DNA fragments of known size.
A 1.5‑kb fragment of DNA is cloned into a plasmid vector that is 5.5 kb long at the EcoRI site, and the plasmid vector is then used to transform bacteria. If the plasmid DNA is then extracted from a single bacterial colony and digested with EcoRI, what digestion products will be produced if the plasmid contains the fragment?

A. One 5.5‑kb fragment
B. One 7‑kb fragment
C. One 1.5‑kb fragment and one 5.5‑kb fragment
D. One 1.5‑kb fragment
C. One 1.5‑kb fragment and one 5.5‑kb fragment. EcoRI digestion will produce two fragments corresponding in size to the 1.5‑kb fragment cloned into the plasmid plus the 5.5‑kb plasmid itself.
Digestion of a 1.1‑kb fragment of DNA with BamHI produces two fragments of 700 bp and 400 bp. Digestion of the same 1.1‑kb fragment with XhoI produces two fragments of 300 bp and 800 bp. Digestion with both enzymes produces three fragments of 100 bp, 300 bp, and 700 bp. Which of the following statements is true about the DNA fragment?

A. The BamHI site is located within the XhoI 300‑bp fragment.
B. The XhoI site is located within the BamHI 400‑bp fragment.
C. The XhoI site is located within the BamHI 700‑bp fragment.
D. The BamHI site is located within the XhoI 100‑bp fragment.
B. The XhoI site is located within the BamHI 400‑bp fragment. Since double digestion produces a 100‑bp fragment and a 300‑bp fragment, the XhoI site must be located within the BamHI 400‑bp fragment.
Which of the following statements about ddNTPs is true?

A. They have an oxygen at the 2′ carbon of the sugar.
B. They have a hydrogen at the 3′ carbon of the sugar.
C. DNA polymerase can add a new dNTP to a 3′ ddNTP.
D. They have a free 3′‑hydroxyl group on the sugar.
B. They have a hydrogen at the 3′ carbon of the sugar. ddNTPs terminate synthesis because there is no 3′‑hydroxyl group onto which DNA polymerase can add nucleotides.
DNA fragments that are 600 bp long will migrate more quickly through a sequencing gel than fragments that are 150 bp long.
False. Small DNA fragments have less hindrance in moving through the gel, so they migrate more quickly than larger fragments.
Which of the following statements about manual Sanger sequencing is true?

A. The DNA sequence obtained is complementary to the template strand.
B. The DNA sequence is read from the top of the gel to the bottom.
C. One sequencing reaction is performed.
D. Each of the four terminating ddNTPs is labeled with a different fluorescent dye.
A. The DNA sequence obtained is complementary to the template strand. The DNA fragments produced in sequencing reactions are synthesized by DNA polymerase to be complementary to the template strand.
How does shotgun cloning differ from the clone-by-clone method?

A. The location of the clone being sequenced is known relative to other clones within the genomic library in shotgun cloning.
B. Computer software assembles the clones in the clone-by-clone method.
C. The entire genome is sequenced in the clone-by-clone method, but not in shotgun sequencing.
D. No genetic or physical maps of the genome are needed to begin shotgun cloning.
D. No genetic or physical maps of the genome are needed to begin shotgun cloning. Shotgun cloning randomly sequences clones with no prior knowledge of their location in the genome.
CpG islands and codon bias are tools used in eukaryotic genomics to:

A. find regulatory sequences.
B. differentiate between eukaryotic and prokaryotic DNA sequences.
C. look for DNA-binding domains.
D. identify open reading frames.
D. identify open reading frames. Cytosine and guanine doublets are concentrated near gene-rich regions of the genome. Codon bias is the phenomenon often observed in coding regions of DNA for certain codons to be used over others coding for the same amino acid.
The study of orthologs would be useful to determine the function of a specific gene in a species
True. Because orthologs are descended from a common ancestral gene, they tend to have the same function in different species. If the function of a gene in one species were known, then its ortholog in a different species would most likely have that same function.
What is not a characteristic of the human genome?

A. It contains over 3 billion nucleotides.
B. At least 50% of the genome contains approximately 20,000 protein-encoding genes.
C. The human genome contains approximately 20,000 protein-encoding genes.
D. Human genes are similar in size to those of invertebrates with similar sized introns.
D. Human genes are similar in size to those of invertebrates with similar sized introns. Human genes are larger than invertebrates with larger introns.
Globin superfamily diversity arose primarily from:

A. alternative exon splicing.
B. developmentally timed expression.
C. gene duplication and divergence.
D. posttranslational modification.
C. gene duplication and divergence. The ancestral human globin gene was probably duplicated into two sister genes about 800 million years ago, which then diverged to give rise to the present-day genes.
Some restriction enzymes cleave DNA in such a manner as to produce blunt ends. Most often ligation of blunt end fragments is enhanced by the use of the enzyme terminal deoxynucleotidyl transferase. why?
Terminal deoxynucleotidyl transferase extends single-stranded ends by the addition of nucleotide tails. If complementary tails are added, the fragments can hybridize and the recombinant molecules can be ligated.
One of the dominant features of the immune system is the capacity to generate new cells that contain different combinations of antibodies. Because there are billions of combinations it is impossible for each combination to be encoded by a single gene. Explain how such diversity is accomplished in the case of the light chain of a typical antibody.
It is achieved by the process of somatic recombination:
1. one of the 70-100 L-V segments joined to one of 6 J regions
2. recombination to J region is imprecise over a 6 bp region
3. break and nibble mechanism adds or removes bases during this recombination process
4. introns spliced out
5. translation produces light-chain polypeptide
6. leader polypeptide removed, producing mature light chain