BBL NYUCD C/O 2021 questions from final review lecture session

What is the role of enamelin in enamel formation?

a) Assembles into gel network for crystal growth guidance

b) Prevents cracks from propagating through enamel mineral

c) Responsible for initial crystal growth at DEJ

d) Defines sheath region and crystal elongation
Click the card to flip 👆
1 / 13
Terms in this set (13)
What is the role of enamelin in enamel formation?

a) Assembles into gel network for crystal growth guidance

b) Prevents cracks from propagating through enamel mineral

c) Responsible for initial crystal growth at DEJ

d) Defines sheath region and crystal elongation
b) Prevents cracks from propagating through enamel mineral
Which protein(s) are implicated in dentinogenesis imperfecta?

a) Proteoglycans

b) Type I collagen

c) DMP-2

d) DMP-1
c) DMP-2
Where does ACP formation begin?

a) In the matrix vesicle

b) In the mitochondria

c) Inthe extracellular matrix

d) In the collagen fibril
b) In the mitochondria
Ti implants with increased surface area are more successful than smooth surface
Ti implants because:

a) Increased surface area adds to the overall weight of the implant, making it
more resistant to dislodging

b) Increased surface area allows better mechanical interlocking between the
implant and the growing tissue

c) Increased surface area allows SIBLING proteins to adapt at the Ti implant - bone interface

d) Increased surface area promotes better clotting
b) Increased surface area allows better mechanical interlocking between the
implant and the growing tissue
Which of the following molecules contributes most of its molecular skeleton to
purine synthesis?

a)Asp

b)Gln

c)Gly

d)N10-formyl THF
c)Gly
To make TTP from scratch, which cofactor(s) is (are) required?

a) tyrosine

b) B12

c) N5, N10 methylene tetrahydrofolate

d) arginine
c) N5, N10 methylene tetrahydrofolate
Which of the following pairs of drugs would be effective in the treatment of gout?

a) azaserine, azathioprine

b) allopurinol, oxipurinol

c) allopurinol, hypoxanthine

d) methotrexate, oxipurinol
b) allopurinol, oxipurinol
Which of the following probes has the right characteristics and would be better for gene hybridization?

a) GATATATTAC

b) GATATATTACGATATATTAC

c) GCGCGAT

d) GCGCGATGCGCGAT

e) GCGCGATGCGCGATGCGCGATGCGCGAT
e) GCGCGATGCGCGATGCGCGATGCGCGAT
What electrophoresis technique separates DNA fragments and uses probes to identify bands?

a) Northern blot

b) Western blot

c) Southern blot

d) Microfluidics
c) Southern blot
What is the most common source of many B's?

a) Fruit

b) Vegetables

c) Animal products

d) Nuts
d) Nuts
Certain restriction endonucleases cleave dsDNA and produce short single stranded regions that are also called: a) Flush cut b) Sticky ends c) Diagonal cut d) Transverse cutb) Sticky endsIf a patient is deficient in a particular vitamin B, there is a good chance that they are also deficient in one or more other vitamin Bs a True b Falsea TrueA patient that is deficient in EFAs and manifests deficiency syndromes an be easily treated by administering EFAs to the diet. a True b Falsea True