BIOS 2500 Genetics Final Exam

The anti-codon loop in tRNAs bind to...

promoters
amino acids
codons in mRNA
RNA polymerases
Click the card to flip 👆
1 / 138
Terms in this set (138)
The anti-codon loop in tRNAs bind to...

promoters
amino acids
codons in mRNA
RNA polymerases
codons in mRNA
Codon preference can be a mechanism for cells to regulate...

the amount of protein produced from a mRNA
the stability of mRNA
the stability of protein
protein modification
the amount of protein produced from a mRNA
Unique genes in a eukaryotic cell are frequently transcribed by...

RNA pol IV
RNA pol I
RNA pol III
RNA pol II
RNA pol II
Dideoxynucleotides are used in...

RNA synthesis in a cell
DNA sequencing
RNA replication in a cell
DNA replication in a cell
DNA sequencing
The pattern of modifications that can occur on histone amino termini that regulate condensation and other proteins' access to DNA is referred to as the...

histone code
phosphorylation of the tails
condensation reaction
Barr body
histone code
Given a strand of RNA "AGGCUAACA" how would it be read during translation? ignore lack of AUG

AGG then CUA
AGG then GGC
AGG then GCU
AGG then UAA
AGG then CUA
The best definition of transmission genetics would be the study of inheritance of...

the molecular structure of several genes
the molecular structure of a single gene
multiple genes that control a single trait between several individuals and their offspring
a single gene that controls a single trait between individual parents and offspring
a single gene that controls a single trait between individual parents and offspring
Which statement is true?

Enzymes usually do not distinguish between deoxyribonucleotides and ribonucleotides
Some errors in DNA synthesis are due to the DNA polymerase frequently using ribonucleotides
Enzymes usually do distinguish between deoxyribonucleotides and ribonucleotides
RNA is not a polynucleotide while DNA is a polynucleotide
Enzymes usually do distinguish between deoxyribonucleotides and ribonucleotides
Which type of organism typically has a single, circular chromosome that comprises its genome?

prokaryote
eukaryote
human
virus
prokaryote
For an RNA polymerase to bind to its appropriate promoter region what must first occur?

General transcription factors must first bind to the promoter
Specific transcription factors must first bind to the promoter
Sigma factor must bind to the promoter region
Sigma factors with general transcription factors must bind to the promoter region
General transcription factors must bind to the promoter
The three steps in order in translation are elongation, termination, initiation initiation, termination, elongation initiation, elongation, termination termination, elongation, initiationinitiation, elongation, terminationWhat is true about eukaryotic replication origins? they are not used at the same time there is only one replication unit per chormosome they are clustered at the ends of chromosomes they are spaced at even distances throughout the chromosomesthey are not used at the same time*add picture of graph*DNA replication (polymerization) by DNA pol III occurs in which direction? 3' to 5' can be both 3' to 5' and 5' to 3' 5' to 3' depends on if replication is bidirectional or unidirectional5' to 3'An mRNA is isolated from an organism, and it is discovered that the mRNA contains a 7 methyl guanine at its 5' end followed by two methylated nucleotides. It could be concluded that the organism.... is preparing to divide is E. coli has a nucleoid has a nucleushas a nucleusWhat structures are found at the very ends of all eukaryotic chromosomes? centromeres telomeres replication origins transcribed genestelomeresTelomerase is a ribonucleoprotein complex that... ligates telomeres together separates ligated telomeres degrades telomeres maintains the length of telomeresmaintains the length of telomeresWhat are the nucleotides found at the end of every tRNA? TTG CCA AAC GAACCAA designation of +1 for a nucleotide with respect to transcription would mean that... the nucleotide is the last nucleotide of the promoter the nucleotide is frequently the first nucleotide in the transcript the nucleotide is the first nucleotide to be transcribed the nucleotide is part of the TATA boxthe nucleotide is frequently the first nucleotide in the transcriptWhat activity do DNA polymerases have that RNA polymerases do not? 3' to 5' exonuclease 5' to 3' polymerase 3' to 5' polymerase ligase3' to 5' exonucleaseThe conclusion of the Beadle and Tatum experiment was that... two genes make at least 5 proteins two genes make one protein one gene makes one protein one gene makes many proteinsone gene makes one proteinThe majority of sequences found in the human genome are classified as... unique sequence moderately and highly repetitive sequences centromeres telomeresmoderately and highly repetitive sequencesThe Griffth's experiment where the mice were injected with different types of bacteria demonstrated that.... DNA was the inheritable material a factor could be transferred from dead to live cells and set up an experimental model DNA consisted of genes chromosomes carried inheritable materiala factor could be transferred from dead to live cells and set up an experimental modelThe H2A histone family is primarily involved in... formation of the scaffold formation of the nucleosome formation of the 30 nm fiber condensing DNA during mitosisformation of the nucleosomeThe Shine-Delgarno sequence in E. coli is used to... orient the translation machinery to the 3' end of mRNA orient the translation machinery to the 5' end of mRNA transport mRNA out of the nucleoid stabilize mRNAorient the translation machinery to the 5' end of mRNAThe process of copying DNA into RNA is known as.... replication modification translation transcriptiontranscriptionA nucleosome consists of... an octet of histones only an octet of histones with approximately 145 nucleotides of DNA an octet of histones with 145 nucleotides of DNA and H1 histone H1 histone with 145 nucleotides of DNAan octet of histones with approximately 145 nucleotides of DNAA region of a chromosome that typically does not contain transcribed genes is... chromatin euchromatin heterochromatin nucleoidheterochromatinOkazaki fragments are resolved by... DNA pol III and ligase DNA pol III DNA pol I and ligase DNA pol IIDNA pol I and ligaseThe composition of an organism's genome is determined to be 30% G. If the organism has a genome that is single stranded DNA, then the amount of A is... 30% 20% 10% Cannot tell from the information givenCannot tell from the information givenWhat element or factor do DNA polymerases need that RNA polymerases do not? Promoter Template Either deoxynucleotides or ribonucleotides PrimerPrimerThe purpose of chromosomal compaction is to... condense the DNA so that it fits into a cell and control transcription only condense the DNA only control transcription silence regions of DNAcondense the DNA so that it fits into a cell and control transcriptionRNA pol III transcribes which genes? tRNA and 5S RNA rRNA mRNA miRNAtRNA and 5S RNAGiven a strand of RNA "AGGCUAACA" what would be the amino acids that would be coded for in this segment? *ignore lack of AUG* Ser Ala Met Arg Gly Thr Ser Ala Ala Arg Leu ThrArg Leu ThrIn the Meselson and Stahl experiment on DNA replication, the semi-conservative model for DNA replication was accepted and the conservative model rejected because....DNA from cells shifted into 14N media from 15N media migrated as a single band after one round of replicationA looped chromosomal domain forms when... the H1 histones join DNA molecules DNA condenses during mitosis the 30 nm fiber attaches to scaffolding proteins chromosomes are treated with salt and detergentthe 30 nm fiber attaches to scaffolding proteinsA nucleotide consists of... pentose sugar, nitrogenous base, and phosphate group pentose sugar and nitrogenous base only nitrogenous base and phosphate group only pentose sugar and phosphate group onlypentose sugar, nitrogenous base, and phosphate groupAn example of molecular genetics would be the study of... the frequencies of different alleles in a population the patterns of inheritance of height in a population the structure of chromosomal DNA the inheritance of eye color between parents and offspringthe structure of chromosomal DNAThe process where an exon from one gene is added to the transcript from another gene is known as... trans-splicing mRNA editing polyA addition cappingtrans-splicingIn the Avery McLeod and Macarty experiment, the purpose of treating extracts with RNase was to demonstrate that the change in phenotype was not due to the presence of.... RNA DNA protein lipidRNA*add picture of graph*What is not a property of double stranded DNA typically found in a cell? strands are helically coiled one strand's 5' end is next to the other's 3' end sugar phosphate back bone is on the interior of the DNA molecule there are major and minor groovessugar phosphate back bone is on the interior of the DNA moleculeDegeneracy in the codon table supports which hypothesis? stop codons are used to terminate protein synthesis codons consist of 3 nucleotides one codon is used for every amino acid Wobble hypothesiswobble hypothesisThe fact that some codons are found less frequently in a specie's mRNA and that this is correlated with the abundance of tRNAs for that codon is referred to as... codon abundance codon preference tRNA selection mRNA dependencecodon preferenceThe basic structure of a gene from either eukaryotes or prokaryotes is that it consists of which parts (starting at the 5' end of the gene)? promoter, transcribed region, terminator terminator, promoter, transcribed region transcribed region, terminator, promoter transcribed region, promoter, terminatorpromoter, transcribed region, terminatorIn the Hersey-Chase experiment with T2 phage, why would the experiment have failed if they had tried to label DNA with radioactive oxygen molecules? DNA does not contain any oxygen only DNA contains oxygen only proteins contain oxygen Both DNA and proteins contain oxygenBoth DNA and proteins contain oxygenThe function of the primosome is to... enhance DNA polymerase I activity create primers for DNA polymerase III to use inhibit DNA polymerase III activity create DNA from primer for DNA pol I to usecreate primers for DNA polymerase III to useThe sugar that is found in nucleotides and is lacking a 2' hydroxyl group but does have the 3' hydroxyl group is known as what kind of sugar? ribose deoxyribose dideoxyribose diribosedeoxyriboseWhat is generally true about genome size and organismal complexity? Humans have the largest genome size since we are the most complex of organisms The less complex the organism, the more complex the genome The more complex the organism, the bigger the genome There is no apparent correlation between genome size and organismal complexityThere is no apparent correlation between genome size and organismal complexityGiven the sequence of a fragment from a non-template DNA strand below " 5' GATCAGGATGC 3' " what would be the mRNA that would be produced from this transcribed region? Note that all sequences are written in the 5' to 3' direction CGUAGGACUAG GCAUCCUGAUC GAUCAGGAUGC None of these sequences given would be correctGAUCAGGAUGCAn example of a monocystronic gene would be... lacI lacO lac operon trp operonlacIA prokaryotic genetic element that can replicate on its own and exist independently of the host chromosome is known as a... composite transposon IS element episome non-composite transposonepisomeWhich action would probably result in increased transcription? introduction of a histone variant into a nucleosome which allows greater condensation of the DNA histone eviction decreasing nucleosome spacing increased association of the DNA with the nucleosomeshistone evictionThe inducer for the lac operon is... allolactose beta galactose glucose galactoseallolactoseIf a bacterial strain has the genotype " lacI+ lacO+ lacZ- lacY+ " then which statement would be correct? active beta galactosidase will be produced when inducer is present active permease will be produced when inducer is present active beta galactosidase will be produced constituitively active permease will be produced contituitivelyactive permease will be produced when inducer is presentGiven the following partial mRNA sequence, what would be the expected amino acid that is translated? " 5' 7methylGAGCAGGAUGCCCGGG 3' " Met-Pro-Gly Glu-Gln-Asp-Ala-Arg Glu-Gln-Met-Pro Met-Ala-Pro-AlaMet-Pro-Gly*add pic of graph*For which codon is there no charged tRNA? ACG TTC TAG CCCTAGNon-homologous eukaryotic chromosomes can be distinguished from each other based on which properties? A) Banding patterns after staining B) Size C) Where the centromeres occur on the chromosome All of the above Only A and CAll of the aboveAn RNA that can bind to an mRNA and either result in the inhibition of translation or cause the mRNA to be degraded is known as a(n).... attenuator RNA tRNA miRNA riboswitchmiRNAIf a male has the genotype Ss what will be the genotypes of its gametes? S since s will always be lethal depends on if the cells under go mitosis or meiosis Ss S and sS and s*add pic of graph*Highest transcription rates for the Lac operon will occur when the medium contains what types of concentrations of glucose and lactose? high glucose, high lactose low glucose, high lactose low glucose, low lactose high glucose, low lactoselow glucose, high lactoseWhich is considered to be the simplest prokaryotic mobile genetic element? IS element retrotransposon transposon retrotransposon and transposonIS elementAn antibiotic resistance gene would most likely be found in a(n).... IS element non-composite transposon composite transposon non-composite and composite transposonsnon-composite and composite transposonsLeucine zipper motifs are frequently found in... carbohydrates lipids enzymes specific eukaryotic transcription factorsspecific eukaryotic transcription factorsGiven the genotype for a bacterial strain lacI+ lacO+ lacZ- lacY+ lacI- lacO+ lacZ+ lacY+ which statement is correct? active permease will be produced constituitively inactive beta galactosidase will be produced constituitively active beta galactosidase will be produced only when inducer is present both active permease and beta galactosidase will be produced constituitivelyactive beta galactosidase will be produced only when inducer is presentIn general, DNA binding proteins recognize the sequences of DNA by recognizing... chemical groups in the major and minor grooves the nucleotides after unwinding the DNA slight differences in the sugar phosphate backbone based on the different nucleotides that some nucleotide combinations such as AT are closer to each other than GCchemical groups in the major and minor groovesIf the DNA sequence "GACATCGACCGATGCATGGGCA" sustains a mutatgenic event so that it is now "GACATCGACCGAACCGATGCATGGGCA" the most likely cause of this event is... a mobile genetic element inserted and then left UV light alkylation deaminationa mobile genetic element inserted and then leftShortening of the poly A tail in mRNAs decreases... transcription transcriptional termination stability of the message use of specific codons such as CCC for prolinestability of the messageThe technique that uses fluorescent probes to detect specific DNA sequences in karyotypes is know as... G banding FISH Fluorescene detection karyotypingFISHIf a mutation is to be passed on from one generation to the next, then the mutation must occur... in the germ line tissue in the somatic tissue early in development late in developmentin the germ line tissueA mutation in the promoter sequence of a gene would have the following effect on transcription.... no change increase decrease all have a possibility of occuringall have a possibility of occuringTypically, peptide hormone receptors are found... in the nuclear membrane in the nucleus at the cell surface in the plasma membrane in the cytoplasmat the cell surface in the plasma membraneThe site in the ribosome where charged tRNAs will enter to match the next codon is known as the... E site A site P site B siteA siteHybrid dysgenesis occurs due to.... an IS element being active in the germ line tissue a transposon being active in the germ line tissue male P type flies being sterile female P type flies being sterilea transposon being active in the germ line tissueFor a small G protein, the G protein will be considered active when it is... bound to ATP stimulated by hormones bound to GDP bound to GTPbound to GTPWhat would be the result if the Shine-Delgarno sequence was deleted from a prokaryotic mRNA? message would not be translated message would immediately be degraded message would not be transported to the cytoplasm there would be an increase in the rate of translation of the messagemessage would not be translatedWhat would be the result if the trp codons in the leader peptide of the trp operon were deleted? there would be no transcriptional control of the operon there would be no control of transcription by the operator region there would be transcriptional control of the operon due to the repressor, but control by attenuation would be lost there would be no change in transcriptional control of the mutated operon compared to the non-mutated operonthere would be transcriptional control of the operon due to the repressor, but control by attenuation would be lostIn meiosis, a cell that is diploid will result in how many haploid cells? 1 2 3 44If a male with the genotype Ss is mated to a female with the genotype Ss, then the probability that they will have offspring with the genotype SS is... 0% 25% 75% 1000%25%Peptide bonds are formed between... ribonucleotides deoxyribonucleotides amino acids steriodsamino acidsA possible mechanism for the creation of new genes is that... a deletion of a gene occurs followed by mutation inversion occurs followed by mutation a gene is duplicated and then mutated simple translocation occurs followed by mutationa gene is duplicated and then mutatedWhich nucleotide in a codon could most likely be mutated yet result in a silent mutation? first second third any nucleotide in the codonthirdNormally, recombination in meiosis occurs between... two non-homologous chromosomes the sister chromatids of homologous chromosomes two centromeres only two telomeres onlythe sister chromatids of homologous chromosomesSteroid hormone receptors when not bound to a hormone are typically found in the... cytoplasm nucleus plasma membrane endoplasmic reticulumcytoplasm5 Methyl cytosine when it is deaminated forms... Guanine Adenine Uracil ThymineThymineIf the DNA sequence "GATCAGATAGGATAGACAGCAGCAGCAGCAGCAGCGGGATAGACCCCAT" sustains a mutatgenic event so that it is now "GATCAGATAGGATAGACAGCAGCGGGATAGACCCAT " the most likely cause for this event is... UV light alkylation error in DNA replication deaminationerror in DNA replicationIf a female with a genotype of Ss is mated to a male with the genotype of SS, the the probability that one of their offspring will have the dominant trait is... 0% 25% 75% 100%100%*add pic of graph*A mutation that results in a codon being changed from CCC (Pro) to ACC (Thr) would be classified as... Transversion, nonsense Transversion, missense Transition, silent Transition missenseTransversion, missenseRetrotransposons are found in... Prokaryotes Eukaryotes E. coli all the aboveEukaryotes*add pic of graph*It was demonstrated that transposition by the Ty retrotransposon occurred through an RNA intermediate because... the plasmid had an intron and the inserted transposon did not treating of the cytoplasm with RNAse resulted in no transpostion blocking RNA polymerase activity blocked transposition blocking DNA polymerase activity blacked transpositionthe palsmid had an intron and the inserted transposon did notIf a male has the genotype Ss Rr, what will be the genotypes of its gametes? Sr and sR SR and sr Ss and Rr SR, Sr, sR, and srSR, Sr, sR, and srAn Ames assay is conducted on a new compound with the results given Treatment Number of colonies no compound 53 compound alone 75 compound w/ liver extract 12383 What is the most reasonable conclusion that would be drawn from these results? the compound is safe for human consumption there is no conclusion that can be drawn with regard to the mutagenicity of the compound the bacteria have a high reversion rate the compound should not be approved for human consumptionthe compound should not be approved for human consumptionAn Ames assay is conducted on a new compound with the results given Treatment Number of colonies no compound 53 compound alone 75 compound w/ liver extract 12383 What is the significance of having the result of the "no compound" count? it indicates the forward mutation rate it indicates the reversion rate it shows that the bacteria are alive B and Cit indicates the reversion rate*add pic of graph**add pic of graph**add pic of graph*If the test cross between two flies results in a phenotypic ratio of 1:5:5:1 instead of the expected ratio of 1:1:1:1, it most likely means that the genes controlling the phenotypic traits are... linked not linked on separate chromosomes lethallinkedIf a man with blood type A has children with a woman who has blood type O, what blood types could the children have? A B O A and OA and OWhat type of mating will produce all normal sized pups in mice? male is igf2-/igf2- female is igf2+/igf2+ male is igf2+/igf2+ female is igf2-/igf2- male is igf2-/igf2+ female is igf2-/igf2- male is igf2-/igf2+ female is igf2+/igf2-male is igf2+/igf2+ female is igf2-/igf2-What is true about genes that are on the same chromosome? the closer they are, the more frequently they will be recombined the closer they are, the less frequently they will undergo recombination they will never result in expected Mendelain phenotypic ratios they cannot be shown to be on the same chromosome by FISHthe closer they are, the less frequently they will undergo recombinationIf 2 chickens are bred and the resulting offspring have a phenotypic ratio of 1:2:1 with respect to their feather colors, it indicates that the alleles for feather color are... completely dominant and recessive incompletely dominant co-dominant epistaticco-dominantIn Morgan's experiment with fruit flies he discovered that the inheritance of eye color... did not correlate with the sex of the fly was random and did not follow Mendelian principles or laws could be correlated with the sex of the fly was environmentally influencedcould be correlated with the sex of the flyIf a mother with type O has a child that has blood type A, what are the possible blood types for the father? AB O A or B AB, A, or BABWhat type of map is considered to be the most accurate? FISH cytogenetic linkage physicalphysicalWhat is generally true about recombination? the closer the genes, the more likely it is for recombination to occur between them the farther apart genes are, the more likely it is for recombination to occur between them recombination frequencies greater than 50% indicate that the genes are close Recombination only rarely occursthe farther apart genes are, the more likely it is for recombination to occur between themThe polymerase chain reaction is a method to... sequence DNA amplify specific proteins amplify specific fragments of DNA find open reading framesamplify specific fragments of DNASex is determined in Drosophila by... a plasmid the amount of a specific transcription factor present in the cell a transposon the amount of the SRY protein that is producedthe amount of a specific transcription factor present in the cellThe three steps in a PCR reaction are (in order)... synthesize, anneal, denature anneal, denature, synthesize denature, anneal, synthesize synthesize, anneal, synthesize again, denaturedenature, anneal, synthesizeConjugation occurs between... H+ and H- cells F+ and F- cells cells with an R plasmid cells with a G plasmidF+ and F- cellsThe best term for when the alleles for one gene can mask the effect of the alleles for another gene would be... epistasis incomplete dominance complete dominance simple dominanceepistasisIn Drosophila, sex is determined by.... the ratio of the X chromosome to the autosomes the presence of the Y chromosome whether or not a chromosome is present; females are monosomic whether or not a chromosome is present; females are heterogameticthe ratio of the X chromosome to the autosomesThe mitochondrial chromosome is located in the... mitochondrial nucleoid mitochondrial nucleus cellular cytoplasm endoplasmic reticulummitochondrial nucleoidIn which mechanism is naked DNA taken up by the cell and then incorporated into a prokaryotic chromosome? conjugation generalized transduction specialized transduction transformationtransformationThe term for a change in allelic frequencies that occur due to a catastrophic event that reduces the size of a population is... founder effect random genetic drift bottle neck effect migrationbottle neck effectWith maternal effect inheritance, such as the twisting of snail shells, inheritance of the phenotypes in offspring are dependent on... maternal genotype only paternal genotype only maternal and paternal genotypes maternal mitochondriamaternal genotype onlyWhen an individual has the alleles necessary to have a particular phenotypic trait but does not have any of the trait, it is an example of... incomplete penetrance variable expressitivy constant expressivity A and Cincomplete penetranceIn phenotypes controlled by maternal mitochondrial and chloroplast inheritance, the phenotypes of the offspring are controlled by the.... paternal nuclear genotype maternal nuclear genotype paternal organelles maternal organellesmaternal organellesIn some reptiles, sex determination can be influenced by what environmental condition? rain fall light temperature wind conditionstemperature*add pic of graph*Which technique will produce the most accurate map of prokaryotic genomes? sequencing interrupted mating transduction transformationsequencingAn Hfr cell is one where... the F episome is integrated into the host chromosome the F episome is not integrated into the host chromosome the cell is lac+ the cell is lac-the F episome is integrated into the host chromosomeWith sex-influenced traits such as baldness, the sex of the individual affects the... phenotype of the individual genotype of the individual genotypic ratios of the progeny ability of the alleles to properly sort into the gametephenotype of the individualA cline is defined as a systematic variation in allelic frequency across... temperature geography time altitudegeographyWhich mechanism of exchange of DNA between two prokaryotic cells uses a structure known as a pilus? conjugation specialized transduction generalized tranduction transformationconjugationTransfer of an F episome to an F- cell from an F+ cell results in... two F- cells one F+ and one F- cell two F+ cells transfer of host chromosomes to F- cellstwo F+ cellsWhat situation will typically give rise to expected Mendelian phenotypic ratios? alleles are co-dominant there are multiple alleles for a single gene alleles are incompletely dominant simple dominant recessive relationship between two allelessimple dominant recessive relationship between two allelesIf genes are considered to be linked, it means that they are... on the same chromosome on different chromosomes following Mendel's law of assortment involved in epistasison the same chromosomeIn which mechanism will a bacteriophage transfer a random piece of host chromosomal DNA to a new cell? transformation specialization transduction generalized transduction conjugationgeneralized transductionIn the mating of yeast, if a petite strain is mated with a normal strain and all of the spores are normal, it indicates that the defect causing the petite phenotype is located in the... mitochondrial genome nuclear genome chloroplast genome cannot tell from the information givenmitochondrial genomeGene maps are useful for identifying... the function of a gene disease genes RNA transcripts nucleosome positioningdisease genesTwo viruses do not productively infect cells separately. However, when the viruses infect cells together they will always produce virus particles. The best term for this phenomenon is... transduction conjugation complementation transformationcomplementationIf two genes have a recombination frequency of 50%, it means that they are... linked not linked on the same chromosome not following Mendel's law of assortmentnot linkedWith imprinting, methylation is erased and reestablished during.... somatic cell differentiation both mitosis and meiosis mitosis meiosismeiosisA female plant with white leaves is mated to a male plant with green leaves, and all the offspring have white leaves. If a female plant with green leaves is mated to a male plant with white leaves, the progeny all have green leaves. This is most likely an example of... mitochondrial inheritance chloroplast inheritance paternal inheritance imprintingchloroplast inheritance