Genetik

STUDY
PLAY

Terms in this set (...)

Griffiths zeigte in seinem Experiment zur Übertragbarkeit von genetischer Information, dass?
Hitzeinaktivierte S Stämme Ihre Information auf R Stämme übertragen

Zusatzinfo: S=smooth, R=rough (Bakterien dieser Lungenkrankheit, Pneumokokken kommen in der S-Form vor) Experiment: Tote S-Form wurde in R-Form hineingegeben, R-Form wurde krank und man hat wiederum lebende S-Form gefunden.
Welche Basen sind Purinnukleotide in der DNA?
Guanin und Adenin

Eselsbrücke: Gerner und Albi = PURe Liebe
Eukaryotische Chromosomen bestehen aus?
-DNA komplexiert mit Histonen
-DNA (Kommt in Chromatin vor)
-DNA komplexiert mit Proteinen (Kommt in Chromatin vor)
Prokaryonten unterscheiden sich von Eukaryoten?
-im Aufbau ihrer Ribosomen
-im Aufbau der Zellwand. Bei Pflanzen und
Bakterien, aber eben anderer Aufbau
-indem sie ringförmige DNA besitzen
Meselson und Stahl zeigten in ihrem Experiment das?
Dass die DNA semikonservativ repliziert
Hershey und Chase zeigten in ihrem Experiment mit T2 Bakteriophagen dass?
DNA als Träger der Erbinformation dient (da aus Nukleinsäuren)
Sind alle vier DNA Basen (A,G,C,T) in einem bestimmten DNA Fragment unbestimmter Länge gleich häufig vorhanden, so ist die Wahrscheinlichkeit, dass eine Base an einer unbestimmten Position vorkommt ¼. Die Wahrscheinlichkeit, dass die Sequenz GATC, welche durch das Restriktionsenzym Sau3A erkannt wir, in dieser Abfolge vorkommt beträgt somit?
1/256

Rechnungsweg: (1÷4) x (1÷4) x (1÷4) x (1÷4) = 1÷256 (0,00390625)
DNA Replikation ist immer?
semikonservativ
Während der Replikation läuft die DNA Synthese am leading und lagging strang?
nur von 5' nach 3'
Nachdem ein Stück DNA repliziert wurde, wird der RNA Primer entfernt von?
DNA Polymerase 1

Zusatzinfo: DNA polymerase I. = Reparatur von geschädigter DNA & RNase 4
DNA polymerase III. = Katalyse an DNA-Matrize DNA helicase = Auflösen von Basenpaaren
RNA primase = Verdoppelung des Erbmaterials DNA ligase = Verknüpfung der Stränge
Welche enzymatische Aktivität ist verantwortlich für die proofreading Aktivität der DNA Polymerase 1?
3'-to-5' Exonuclease Aktivität
Falsche Basenpaarungen sind während der Replikation gering, da?
ein Reparatur-Mechanismus die falsch gepaarten Basen repariert
Okazaki Fragmente ? (aus DNA/RNA, kurzer Abschnitt während der DNA-Snythese)
-haben einen RNA Primer
-verlaufen von 3' nach 5'
-werden für die lagging strand Synthese benötigt. (-> Mutterstrang 3'-5')
Die Umschreibung der DNA in RNA?
-erfolgt durch eine RNA-Polymerase
-nennt man Transkription

Zusatzinfo: RNA-Polymerase = katalysiert die Herstellung der RNA-Kopie vom DNA-Matrizenstrang
Bei der Transkription oder DNA Replikation wird ein neues Nukleotid immer an welchen vorhandenen Rest synthetisiert?
3' OH (Hydroxygruppe; nukleophiler Angriff)
Die prokaryotische Replikation ist in erster Linie das Ergebnis einer?
-Zweiteilung (Klone)
Die Translation einer eukaryotischen mRNA beginnt immer?
-Am ersten Codon (Start Codon auf mRna)
-An dem, dem 5' Ende nahegelegensten AUG triplett. (codiert Methionin)
Eine prokaryotische mRNA wird? (=oft als Operon organisiert -> mehrere Gene auf einmal transkribiert)
-während der Transkription prozessiert
-während der Transkription translatiert
Die Translation kann inhibiert werden durch?
-„Riboswitches". (Ribosombindungsstelle im Inneren -> kein Start)
-Chloramphenicol. (Antibiotika, bei R50S ribosomaler Untereinheit)
-Sigma-Faktoren. (=Sigma-Aldrich)
Ef-TU? (=Elongations Faktor)
bindet eine amino-acyl tRNA und bindet an die A-site des Ribosoms
Translation der RNA in Proteine erfolgt bei Eukaryoten?
im Zytoplasma. (Ribosome -> Mitochondrien/Choroplasten)
Gegeben ist der coding strand eines eukaryotischen Gens. Untranslatierte Regionen und Introns sind in Kleinbuchstaben geschrieben. Der Transkriptionsstart ist Unterstrichen. gatatactat caagctGGGC ATGAGCTACA TGCAGTCAG Cgtcattcga cgccagagac atggcagCTC CTGAacgctac aaaataaacgt 3' Die mRNA dieses Genes lautet?
capGGGCAUGAGCUACAUGCAGUCAGCCUCCUGAACGCUACAAAAAAAAAA AAAAAAAAAA+. (T durch U ersetzen)
Gegeben ist der coding strand eines eukaryotischen Gens. Untranslatierte Regionen und Introns sind in Kleinbuchstaben geschrieben. Der Transkriptionsstart ist Unterstrichen. 5' gatatactat caagctGGGC ATGAGCTACA TGCAGTCAG Cgtcattcga cgccagagac atggcagCTC CTGAacgctac aaaataaacgt Nach Transkription und Prozessierung der RNA wird folgendes Protein gebildet?
Met-Ser-Tyr-Met-Glu-Ser-Ala-Ser-Stop
Die Aminosäureabfolge Met-Arg-Lys-Ser-Leu-Thr-Val-Stop Kann durch welches DNA Fragment kodiert werden? Nutzen Sie den Code (GenFig5)
ATG CGA AAA AGC CTC ACA GTC TGA
Angabe: Gegeben sind verschiedene Genotypen des Lac-Operons. Partielle Diploide können durch ein F'-Plasmid geschaffen werden. D.h. eine Kopie ist am bakteriellen Chromosom, eine zweite Kopie auf einem Plasmid vorhanden. Oc ist ein Operator welcher dem Repressor gegenüber insensitiv ist. I- ist ein defekter Repressor (bindet keine DNA). Es ist ein Repressor, welcher gegenüber Laktose insensitiv ist. Frage:
Bei folgendem Genotyp I+ 0+ Z+ wird LacZ
Nur in der Gegenwart von Lactose exprimiert
Angabe: Gegeben sind verschiedene Genotypen des Lac-Operons. Partielle Diploide können durch ein F'-Plasmid geschaffen werden. D.h. eine Kopie ist am bakteriellen Chromosom, eine zweite Kopie auf einem Plasmid vorhanden. Oc ist ein Operator welcher dem Repressor gegenüber insensitiv ist. I- ist ein defekter Repressor (bindet keine DNA). Es ist ein Repressor, welcher gegenüber Laktose insensitiv ist.
Frage: Bei folgendem Genotyp: IS OC Z+ Wird LacZ?
Immer exprimiert
Die Attenuierung der Regulation des trp Gens wird bewirkt durch?
-einen Block in der Expression der Trp mRNA
-die Ausbildung alternativer Strukturen in der Trp mRNA
Missense Mutationen?
Verändern die Identität der codierten Aminosäure
Nonsense Mutation?
Führen ein Stop Codon ein
Eine Mutation, welche zum Einbau einer ähnlichen Aminosäure in einem Protein führt ist eine?
Neutrale Mutation
Eine Mutation, welche ein Codon verändert, aber nicht zum Einbau einer anderen Aminosäure im translatierten Protein führt ist eine?
Stille Mutation
Eine Mutation, welche ein Stop Codon in ein Gen inseriert, ist eine?
Nonsense Mutation
Desaminierung von Cytosin?
-wird an der DNA durch ein Reparatursystem erkannt
-führt zur Bildung von Uracil
-führt zu einer fehlerhaften Basenpaarung
Mismatch repair in Prokaryoten: Der "alte" DNA Strang wird erkannt anhand der?
Methylgruppen (Bei Mutterstrang)
Defekte im Mismatch repair von Eukaryoten sind Ursache von?
Krebs
Der Ames Test dient zum Nachweis von? (Identifikation von Mutagenen
Genotoxischen Substanzen. (äußere Einwirkungen, die Erbgut verändern)
Xeroderma pigmentosum (Mondscheinkrankheit) ist eine menschliche Erbkrankheit verursacht durch? (Chromosomenbruchsyndrom)
einen defekten Excision repair.- Mechanismus
Tumor Suppressor Gene? (Verhindern Tumor-Bildung -> unterdrückt unkontrollierte Zellteilung)
kontrollieren die Integrität der DNA und deren korrekte Aufteilung im Zellzyklus
Mendels Unabhängigkeitsregel besagt, dass? (Neukombination der Gene)
-unterschiedliche Merkmale immer unabhängig voneinander vererbt werden
-unterschiedliche Merkmale welche nicht gekoppelt sind, unabhängig vererbt werden
Ein Träger einer Erbkrankheit? (Konduktor)
-ist heterozygot für die rezessive Mutation. (-> Träger gesund)
Wie konnte Garrod "Alkaptonurie" (=autosomal rezessive Krankheit) als eine rezessive genetische Erkrankung identifizieren?
Die Krankheit wird nur manifest wenn beide Allele betroffen sind

(Beide Allele betroffen, autosomal)
Zwei Individuen welche im Bezug auf Merkmal A als auch B heterozygot sind, werden miteinander gekreuzt. Merkmal A, als auch Merkmal B werden unabhängig voneinander vererbt. Mit welcher Wahrscheinlichkeit treten in der F1 Generation Individuen auf, welche für beide Merkmale heterozygot sind?
¼.

LW: (1÷4 + 1÷4) x (1÷4 + 1÷4) = 1÷4
Während der Mitose?
-Homologe Chromatiden getrennt
-Auf Tochterzellen aufgeteilt
Welche Komponente wird in der PCR nicht benötigt? (polymerase chain reaction, DNA Vervielfältigung)
-ddNTPs (di desoxy NTPs)
Bei der Herstellung transgener Mäuse durch Mikroinjektion von linearisierter DNA in Oozyten wird das Gen in das Genom eingebaut. Dies geschieht vorwiegend in Form?
-als Einzelkopie benachbart zum ursprünglichen Gen. (-> anderes Gen deletiert)
-mehrerer Kopien des Gens an willkürlichen Stellen. (-> fremde DNA von Transgenen in irgendwelchen Stellen vom Genom)
Was ist ein Transgen?
artfremdes Gen, welches einem gentechnisch verändertem Organismus eingebracht wurde
Wie beeinflusst ein Induktor (Molekül, dass Transkription von reguliertem Gen steigert) in der Regel die Transkription? (bindet sich an Repressormolekül)
Der Indikator verhindert, dass der Repressor an den Operator bindet. (an DNA-Bindungsstelle)
Welche der folgeneden Aussagen beschreibt „Reverse Gentik" am besten?
Ein mutiertes Gen wird in einen Organismus eingeführt, um dessen Funktion zu studieren
Wann werden die Centriolen (Zylinderförmige Strukturen für Stützung und Transport) verdoppelt? (während Interphase, Spindelapparat)
S-Phase. (DNA-Synthese und Verdoppelung)
Lac-Operon?
-untersucht von Jacob und Monod

-Spezielles Operon in verschiedenen Bakterien, welches Gene enthält, die Lactose abbauende Enzyme exprimieren. Operon besteht aus Promoter, Operator (1,2&3), sowieso in diesem Fall 3 Gene (LacZ, LacY & LacA) und einem Terminator. Repressor-Gen ist nicht im Lac Operon, sondern davor und hat einen eigenen Promoter, sowie Terminator

-kodiert für ß-Galactosidas (lacZ), Lactose permease (lacY), ß-Galactoside transacetylase (lacA).
Die DNA Replikation von Bakterien erfolgt?
semikonservativ
Im Tryptophan Operon bewirkt die Synthese des „Leader peptides"?
die Termination der Transkription der nachfolgenden Gene des Trp Operons
Um einen konditionellen Gen-Knock out in der Maus durchführen zu können, werden LoxP-Schnittstellen (Entfernung von DNA-Sequenzen in lebenden Organismen) ins Genom eingeführt (LoxP=Floxen), entweder in?
-zwei nicht-kodierende, ein Gen flankierender Bereiche
-flankierende Introns eines Exons
Die Methode des „gene walking" dient zur?
Sequenzierung des zwischen 2 Genen liegenden Nukleotidstranges (Polymerasen-Kettenreaktion PCR)
Welche Komponenten werden in der PCR benötigt? (polymerase chain reaction, DNA Vervielfältigung)
-DNA Polymerase
-Oligonukleotid Primer (an DNA Einzelsträngen angelegt)
-Puffer
-doppelsträngiges DNA template