Upgrade to remove ads
Only $2.99/month

Genetics Chapter 19 & 21

Terms in this set (8)

C1. Discuss three important advances that have resulted from gene
cloning.
First, cloned genes can be used for DNA sequencing. This has allowed
researchers to understand genetics at the molecular level. Second, cloned genes can be
mutated using site-directed mutagenesis to identify gene sequences such as promoters
and regulatory elements and to see how specific mutations alter the structure and function
of DNA. Third, cloned genes can be used as probes to identify similar genes or RNA.
Fourth, cloned genes can be introduced into a different cell type or species. Thus cloning
is useful in biotechnology and clinical therapy, topics discussed more thoroughly in
Chapters 20 and 21.
C2. What is a restriction enzyme? What structure does it recognize?
What type of chemical bond does it cleave? Be as specific as
possible.
A restriction enzyme recognizes and binds to a specific DNA sequence
and then cleaves a (covalent) phosphoester bond in each of two DNA strands.
C3. Write a double-stranded sequence that is 20 bases long and is
palindromic.
Here is an example:
GGGCCCATATATATGGGCCC
CCCGGGTATATATACCCGGG
C4. What is cDNA? In eukaryotes, how does cDNA differ from
genomic DNA?
The term cDNA refers to DNA that is made using RNA as the starting
material. Compared to genomic DNA, it lacks introns.
C5. Explain and draw the structural feature of a dideoxyribonucleotide
that causes chain termination.
A dideoxynucleotide is missing the −OH group at the 3' position. When
the 5' end of a dideoxynucleotide is added to a growing strand of DNA, another
phosphoester bond cannot be formed at the 3ʹ′ position. Therefore, the dideoxynucleotide
terminates any further addition of nucleotides to the growing strand of DNA.
C1. A person with a rare genetic disease has a sample of her
chromosomes subjected to in situ hybridization using a probe that
is known to recognize band p11 on chromosome 7. Even though
her chromosomes look cytologically normal, the probe does not
bind to her chromosomes. How would you explain these results?
How would you use this information to positionally clone the gene
that is related to this disease?
One would conclude that she has a deletion of the gene that the probe
recognizes. To clone this gene, one could begin with a marker that is known to be near
band p11 and walk in either direction. This walking experiment would be done on the
DNA from a unaffected person and compared to the DNA from the person described in
the problem. At some point, the walk would yield a clone that contained a deletion in the
person with the disease, but the DNA would be present in an unaffected person. This
DNA fragment in the unaffected person should also hybridize to the probe.
C2. For each of the following, decide if it could be appropriately
described as a genome:
A. the E. coli chromosome
B. human chromosome 11
C. a complete set of 10 chromosomes in corn
D. a copy of the single-stranded RNA packaged into human immunodeficiency
virus (HIV)
A. Yes.
B. No, this is only one chromosome in the genome.
C. Yes.
D. Yes.
C3. Which of the following statements are true about molecular
markers?
A. All molecular markers are segments of DNA that carry specific
genes.
B. A molecular marker is a segment of DNA that is found at a specific
location in a genome.
C. We can follow the transmission of a molecular marker by analyzing
the phenotype (i.e., the individual's bodily characteristics)
of offspring.
D. We can follow the transmission of molecular markers using
molecular techniques such as gel electrophoresis.
E. An STS is a molecular marker.
A. False, they do not have to carry genes.
B. True.
C. False, the marker may not carry a gene that affects phenotype.
D. True.
E. True.
THIS SET IS OFTEN IN FOLDERS WITH...