How can we help?

You can also find more resources in our Help Center.

112 terms

Biology Midterm for Mrs. Nolan

STUDY
PLAY
codon
Each set of three nitrogen bases in mRNA is referred to as a(n) ___.
cytosine
Adenine is to thymine as guanine is to ___.
nitrogen bases
Thymine, adenine, guanine and cytosine are classified as ___.
thymine
RNA consists all of the same nitrogen bases as DNA except ___.
tRNA
___ brings amino acids to the ribosomes for the assembly of proteins.
anitcodon
Each set of three nitrogen bases of in DNA is known as a ___.
mRNA
During the process of transcription, DNA serves as the template for making ___.
double helix
The 3-D shape of DNA is referred to as a ___.
single stranded
DNA is to RNA as double stranded is to ___.
a sugar, a phosphate group, and a nitrogen base
A nucleotide consists of ___.
sugar
The part of the molecule for which deoxyribonucleic acid is named is the ___.
cytosine
The amount of guanine in an organism always equals the amount of ___.
guanine-cytosine
Which one of the following nucleotide pair bonds would be found in a DNA molecule?
phosphate molecules and deoxyribose sugars
The backbone of a DNA molecule is made of which two components?
the shape of a double helix
Watson and Crick were the first to suggest that DNA is ___.
nitrogen bases
The pairing of ___ in DNA is the key feature that allows DNA to be copied.
replication
The process by which a DNA molecule is copied is called ___.
deoxyribose sugar and thymine
A DNA nucleotide may be made up of a phosphate group, along with ___.
cell, nucleus, chromosome, DNA, nucleotide
Which series is arranged in order from largest to smallest in size?
TCAAGGTGAACT
The order of bases on a DNA strand is AGTTCCACTTGA. What would the complimentary DNA strand be?
GGATCGA
During DNA replication, a complementary strand of DNA is made for each original DNA strand. Thus, if a portion of the original strand is CCTAGCT, then the new strand will be ___.
guanine : cytosine
adenine : thymine
is single-stranded, contains uracil and contains a different sugar molecule (all of the above)
RNA differs from DNA in that RNA ___.
uracil
In RNA molecules, adenine is complementary to ___.
mRNA
Transcription is the process by which genetic information encoded in DNA is transferred to a(n) ___.
carries an amino acid to its correct mRNA codon
Transfer RNA ___.
ribosomes
In order for protein synthesis to occur, mRNA must migrate to the ___.
Leu-Lys-Cys-Phe
What is the portion of the protein molecule coded for by the piece of mRNA shown in the diagram?
GAG-UUC-ACG-AAG
The tRNA sequence for the mRNA above is ___.
GAG-TTC-ACG-AAG
Which of the following would represent the strand of DNA from which the mRNA strand above was made?
phosphate group
All of the following are different betwen DNA and RNA except the ___.
transcription
Messenger RNA is formed in the process of ___.
at the ribosomes
In which part of the cell does this process shown in Figure 1-1 take place?
amino acid
Structure III in Figure 11-1 represents a(n) ___.
translation
The process illustrated in Figure 11-1 is called ___.
UACCGUAUGUUCAAGCUGCCUC
Using Structure II in Figure 11-1, what is the sequence of the tRNA molecule from left to right?
TACCGTATGTCAAGCCTC
Using structure II in Figure 11-1, what is the sequence of the DNA molecule from left to right?
mRNA
Applicants for the fourth job of the Help Wanted ad in Table 11-1, "Supervisor" could qualify if they were ___.
DNA
Applicants for the third job of the Help Wanted ad in Table 11-1, "Executive Position" could qualify if they were ___.
tRNA
Applicants for the second job of the Help Wanted ad in Table 11-1, "Accuracy and Speed" could qualify if they were ___.
point mutation
A DNA segment is changed from AATTAG to AAATAG. This is a ___.
frameshift mutation
A DNA segment is changed from AATTAGAAATAG to ATTAGAAATAG. This is a ___.
mutagens
X-rays, ultraviolet light and radioactive substances that can change the chemical nature of DNA are classfied as ___.
mutation
Any change in the DNA sequence that also changes the protein it codes for is a ___.
point mutation
A ___ is a change in a single base pair of DNA.
frameshift mutation
A ___ occurs when a single base is added or deleted from DNA.
cell cycle
Among the following, the term that includes the others is ___.
lining up of chromosomes in the cell
By the end of prophase, each of the following has occured except ___.
centrioles
Unlike plant cells, animal calls contain ___.
interphase
The longest phase of the cell cycle is ___.
centromere
A chromatid is attached to a spindle fiber by the ___.
organ system
Which of the following structures is the most complex?
A
Which of the cells depicted in the line graph in Figure 8-8 are most likely concerous?
they died off because the cancerous cells deprived them of nutrients.
If cancer is present, what is the likely explanation for what happened to cells B and D?
anaphase
The cell in diagram 1 is in ___.
2
Mitosis begins with the stage shown in diagram ___.
telophase
The cell shown in diagram 5 is in ___.
C, B, A, D
Which of the following correctly indicates the order in which these events occur?
A
During which stage do the centromeres divide?
heredity
The passing of characteristics from parents to offspring.
crossing over
The exchange of genetic material between homologous chromosomes.
fertilization
The uniting of the male and female gametes.
zygote
The cell produced when a male gamete fuses with a female gamete.
meiosis
The type of cell division that produces gametes.
haploid
A cell that contains one member of each chormosome pair.
homozygous
The alleles present for a trait are the same.
crossing over
When an area of a chromatid is exchanged with the matching area on a chromatid of its homologous chromosome, ___ occurs.
genetic recombination
Crossing over results in a ___.
homozygous
Cells containing two alleles for each trait are described as ___.
an egg
The gamete that contains genes contributed only by the mother is ___.
the transfer of the male pollen grain to the female organ
Pollination can best be described as ___.
meiosis and fertilization
The numbers in Figure 10-1 represent the chromosome number found in each of the dog cells shown. The processes that are occurring at A and B are ___.
alleles
Genes located on homologous chromosomes may have alternate forms that control different forms of a trait. These alternate forms of a gene are called ___.
both
Sister chromatids seperate
meiosis
Haploid cells are formed
mitosis
Cell division only occurs once
meiosis
Homologous chromosomes pair
meiosis
Four cells are the final result
meiosis
Cell division occurs twice
both
Replicated chromosomes line up in the middle of the cell
mitosis
Two cells are the final result
mitosis
Diploid cells are formed
meiosis
Daughter cells have one chromosome from each homologous pair
chlorophyll
The main energy-trapping molecule in plants is ___.
thylakoid membranes
Energy from sunlight is trapped by chlorophyll located in the ___.
energy
Chlorophyll traps ___ from sunlight.
chlorophyll
A green pigment that traps energy from sunlight is ___.
ribose
Which sugar is a part of adenosine diphosphate?
two phosphate groups
Energy is released from ATP when the bond is broken between ___.
a cell can't always immediately use all the energy it gets
Organisms need a way of storing energy because ___.
energy
In order to move molecules in your kidneys, your body needs ___.
light reactions release oxygen
In the complete process of photosynthesis, the ___.
two, four
In glycolysis, ___ molecules of ATP are used in the first step, and ___ molecules of ATP are produced in the second step.
oxygen
In respiration, the final electron acceptor in the electron transport chain is ___.
maintain homeostasis
Kidneys use energy to move molecules and ions in order to keep the blood chemically balanced. This process is an example of cells using energy to ___.
6CO2+6H20--->C6H1206+6O2
Which of the following equations best represents photosynthesis?
reflected
Leaves appear green because the green portion of the light that strikes them is ___.
a third phosphate group is bonded to an ADP molecule
Cells store energy when ___.
burning
The energy in glucose cannot be released by ___.
glucose
Which of the following is not a part of adenosine diphosphate?
B
Which of the diagrams in Figure 9-2 best show how energy is produced in a cell?
production of ATP
What is the main purpose of the cycle shown in Figure 9-4?
animals only
In what types of organisms does the process shown in Figure 9-5 take place?
citric acid cycle
A series of reactions in aerobic respiration that begins and ends with the same 6-carbon compound is the ___.
Calvin Cycle
In photosynthesis, the series of reactions that synthesize simple sugars from carbon dioxide and hydrogen is known as the ___.
glycolysis
The anaerobic process of splitting glucose to form pyruvic acid is called ___.
photolysis
The splitting of water during photosynthesis is ___.
electron transport chain
The passing of electrons along a series of molecules, releasing energy as they go, is known as a(n) ___.
photosythesis
The process by which autotrophs use energy from sunlight to build carbohydrates is called ___.
light dependant reactions
The reactions in photosynthesis in which energy from the sun is converted to chemical energy are called ___.
increases in response to increasing light intensity, but only to a certain point
Graph A demonstrates that the rate of photosynthesis ___.
the rate of photosynthesis is affected by changes in the environment
Taken together, these graphs demonstrate that ___.