31 terms

Chapter 20

STUDY
PLAY

Terms in this set (...)

Desribe how you could make a genomic library starting with DNA from your own cells and using the restriction endonuclease EcoRI to cut the genome into fragments that can be inserted into a plasmid vector.
isolate the DNA and cut it into small fragments with EcoRI which leaves sticky ends.
Cut copies of a plasmid or other vector with EcoRI.
Mix fragments and plasmids under conditions that promote complemetnary base pairing by sticky ends of fragments and plasmids
Use DNA ligase to catalyze form ation of phophodiester bonds and seal the sequences
Would each type of cDNA in the library be represented just once? Why?
No many times because many copies of each type of mRNA were present in the pituitary cells and many pitutitary cells were ysed to prepare the library.
Why does the DNA probe have to be single stranded and labeled in order to work and why does it bind to just one specific fragment 373
So that it will bind by complementary base pairing to the target DNA and it must be labeled so that It can be detected. The probe will base pair only with fragments that include a sequence complementary to the probes sequence.
Where a probe with the sequence AATCG will bind to a target DNA with the sequence ttttacccatttacgattggcct 373
A probe would hind to the region of the target DNA that has the sequence 5CGATT3
374 Why restriction endonucleases like EcoRI create DNA fragments with sticky ends
When the endonucleasese makes a starggered cut in a palindromic sequence and the strands separate the single stranded bases that are left will bind to the single stranded bases left where the endonuclease cut the same palindrome ata different location
Why the word probe is appropriate to describe a labeled sequence that is used to find a particular gene in a DNA library
probe means to exame thoroughly. A dna probe examines a large set of sequency and binds to one that has a complementary base sequence
Explain the purpose of denaturation annealing and extension steps in a PCR cycle and why chain reaction is an approrpate part of the term PCR 376
Denaturation- makes DNA single stranded so the primer can bind to the sequneces during the annealing step
Once the primer is in place taq polymerase can synthesize the rest of the strand during the extension step
it is a chain reaction because the products of each reaction cycle are used in the next reaction cycle this is why the number of copies doubles in each cycle
Wirte down the sequence of a double stranded DNA that is 50 base pairs long then design 21 base pair long primers that would allow you to amplify the segment by PCR
...
Explain why labeled ddNTPs have to be present in small numbers relative to the number of unlabeled dNTPs 378
if ddNTPs were present at high concentration they sould almost always be iincorporated meaning that only fragments from the first complementary base in the sequence would be produced
379 Explain why its helpful to hunt for genes using genetic map with many genetic markers rather than only a few.
makes it more liekely that there will bne one marker that is tightly linked to the gene of interest meaning that a form of the marker will almost always be associated with the phenotyle you are tracking
382 How would you identify allesles associated with alcoholism.
Start with a agenetic map with as many polymorphic markers as possible
determine the genotype at these markers for a large number of indiv. who have the same type of alcoholism one with a genetic component
also a number of unaffected individuals
look for particular versions of a marker that is almost always found in affected individuals.
Genes that contribute to a predisposition to alcoholism will be near that makrer
What happens if the recombinant DNA is inserted in the middle of a gene that is critical to normal cell function
the insertion will probrarbly disrupt the gene and have serious consequences for the cell and maybe the indiv
Explain why a plasmid is needed for gene cloning 20.1
special features of DNA are needed to allow replication in a cell. it is unlikely that any dna fragment generated by cutting the dna of one species with a restriction enxyme would replicate when inserted into a bacterial cell. by placing dna fragments witihin plasmids that normally replicate in a bacterial cell the inserted dna can be replicated along with the plasmid
List the advantages and disadvantages of cloning in cells versus using PCR to obtain many copies of genes 20.2
advantages: no knowledge of the sequence is required
disadva: it is slower and technically more difficult than pcr.
PCR
Pcr advan: fast and easy and it can amplify a dna sequence that is rare in the sample
pcr disadvant: it requires knowledge of sequences on either side of the target gene so primers can be designed
20.3 Explain how the newly synthesized DNA fragments when they a are lined up by size can be used to determine the sequences of bases in the template DNA
the length of each fragment is dictated by wherer a ddNTP was incorporated into the growing strand and each ddNTP corresponds to a base on the template strand. thus the sequence of fragment sizes corresponds to the sequence on the template DNA
20.4 Explain why genetic markers that are not polymorphic are not useful in gene hunts
in this case both affected and unaffected individuals would have the same marker so there would be no way to associate a particular form of the marker with the gene and the phenotype you are interested in
1 what do restriction endonucleases do
they cut dna at specific sites known as recognistion sites to produce dna fragments useful for cloning
2 what is a plasmid
b...
3 when present in a dna synthesis reaction mixture a ddNTP molecule is added to the growing chain of DNA and no other nucleotides can be added afterward, why
ddNTPs lack the -OH group on the 3 carbon of deoxyribose sugar that is required to extend the dna chain during synthesis
4 once the gene that causes huntingtons disease was found researchers introduced the defiective allele into mice to create an animal model of the disease. Why was this valuable.
a
5. To begin the hunt for the human growth hormone genes researchers created a cDNA library from cells in the pituitary gland. What did this library contain.
b
6 What does it mean to say that a genetic marker and a disease gene are closely linked
d...
Explaiin how restriction endonucleaseess and DNA ligase are used to insert foreign genes into plasmids and create recombinant DNA.
when a restriction endonuclease cuts a foreign gene sequence and a plasmid the same sticky ends are created on the excised foreign gene and the cut plas,omd. After the sticky ends on the foreign gene and the plasmid anneal dna ligase catalyzes closure of the dna backbone sealing the foreign gene into the plasmid dna
8 if a particular sequence of DNA were amplified using 25 PCR cycles then the amount of this DNA would be predicted to increase by___fold
2 to the 25 fold increase
9 what is cDNA library? Would you expect the cDNA library from a human muscle cell to be different from the cDNA library from a human nerve cell in the same individual? Why?
collection of complementary dnas made from all the mrnas present in a certain group of cells. a cdna library from a human nerve cell would be different from one made from a human muscle cell because nerve cells and muscel cells express many different gens that are specific to their cll type
10 WHat are genetic markers and how are they used to create a genetic map
are genes or other loci that have known locations in the genome. when these locations are diagrammed they represetnt the physical relationships between landmarks--they form a map
11 reserachers add regulatory sequences from an endosperm specific gene to the Ti plasmids used in creating golded rice. This was important to
d...
12 Compare and contrast PCR with the DNA synthesis that occurs in cells
pcr and cellular dna synthesis are similar in the sense of producing copies of a template dna. both rely on primers and dna polymerase . the major difference is that pcr copies only a specific target sequence and in cellular dna synthesis the entire genome is copied..
13 Suppse you had a large amount of sequence data similar to the data that nancy wexlers team had in the region of the huntigtons disease gene and that you knew that mrnas of the species being studied typuically contain protein coding regions about 1500 bases long. How would you use the genetic code and info on the structure of promoters to find the precise location of oone or more gens in you r sequence
you could use a computer program to identify possible promoter sequences in the sequence data and then look for sequences just downstream that have an AUG start codon and codons that could be part of the protein coding exons of a potential protein about 500 amino acids long
15 describe similarigties between how researchers screen a dna library and how they perform a genetic screen for example for mutant e coli cells that cannot metabolize lactose
in both researchers use an indicator to identify either a gene of interest or a colony of bacteria with a particular trait. the problem is the same- picking one particular thing out of a large collection
16
...