How can we help?

You can also find more resources in our Help Center.

490 terms

IB

STUDY
PLAY
A DNA molecule is made up of repeating units of which of the following?
Choose one answer.
a. amino acids
b. nucleotides
c. polypeptides
d. ribose sugars
nucleotides
A gene can be defined as a discrete piece of chemical information that is actually a code for:

a. translation of DNA molecules.
b. assembly of a hormone.
c. assembly of one protein.
d. the regulation of molecules which direct gene activation.
c. assembly of one protein
A genome is:
Choose one answer.
a. all the DNA in an organism
b. all the alleles in a population.
c. only the expressed genes of an organism.
d. all the dominant alleles of an organism.
all the DNA in an organism Correct
A segment of a DNA molecule that provides the information for the sequence of amino acids for one specific protein is a or an:
Choose one answer.
a. chromosome.
b. gene.
c. nucleotide.
d. enzyme.
b. gene.
An enzyme that can join pieces of DNA together is:
Choose one answer.
a. DNA ligase.
b. RNA polymerase.
c. DNA polymerase.
d. Rubisco.
a. DNA ligase
DNA molecules are constructed from nucleotides that are molecules consisting of:
Choose one answer.
a. a base, deoxyribose sugar, and a nitrate group.
b. a base, deoxyribose sugar, and a phosphate group.
c. a base, ribose sugar, and a sulfur group.
d. an amino acid, a tRNA, and a ribosome.
b. a base, deoxyribose sugar, and a phosphate group.
How do DNA and RNA differ?
Choose one answer.
a. DNA is found only in the cytoplasm; RNA is found only in the nucleus.
b. DNA contains the bases A, T, C, G; RNA contains the bases A, U, C, G
c. DNA is a double helix; RNA cannot complementary base pair with anything.
d. DNA is missing an oxygen atom on the phosphate group.
b. DNA contains the bases A, T, C, G; RNA contains the bases A, U, C, G
How do DNA and RNA differ?
Choose one answer.
a. RNA replicates; DNA does not.
b. RNA is short-lived; DNA is long-lived.
c. RNA is only in the nucleus; DNA is only in the cytoplasm.
d. T occurs in RNA in place of U in DNA.
b. RNA is short-lived; DNA is long-lived.
If a species' DNA contains 30% C (cytosine), what is the percentage of A (adenine)in the DNA?
Choose one answer.
a. 60%
b. 25%
c. 30%
d. 20%
d. 20%
If a species' genome is 20% A (adenine), what is the percentage of G (guanine) in the genome?
Choose one answer.
a. 60%
b. 20%
c. 30%
d. 80%
c. 30%
In DNA, the genetic information is contained in the sequence of:
Choose one answer.
a. amino acids.
b. sugars.
c.itrogenous bases. n
d. phosphates.
c.itrogenous bases. n
In the DNA double helix,:
Choose one answer.
a. the order of bases is exactly the same in all individuals of a species.
b. the backbone is held together by weak hydrogen bonds.
c. Gs always pair with As and Cs always pair with Ts.
d. the backbone is RNA and sugars form the rungs of the ladder.
e. the number of As always equals the number of Ts.
e. the number of As always equals the number of Ts.
In the DNA of cell nuclei, the amount of adenine (A) is the same as the amount of which?
Choose one answer.
a. guanine (G)
b. thymine (T)
c. cytosine (C)
d. uracil (U)
b. thymine (T)
In the genetic code, the alphabet has ________ letters and each word is __________ letters long.
Choose one answer.
a. 3, 61
b. 61, 4
c. 4, 3
d. 64, 3
e. 3, 4
c. 4, 3
In the nuclear DNA of a plant cell, the amount of guanine (G) is the same as the amount of:
Choose one answer.
a. uracil (U).
b. thymine (T).
c. adenine (A).
d. cytosine (C).
d. cytosine (C).
Knowing the genome of rice tells us:
Choose one answer.
a. the nitrogenous base sequence of all the chromosomal material.
b. which genes are being expressed at any one time.
c. how many ribosomes are in the cytoplasm.
d. how many chromosomes are in the nucleus.
e. the nitrogenous base sequence of the expressed genes.
a. the nitrogenous base sequence of all the chromosomal material.
One surprise that came from analyzing the results of the Human Genome Sequencing Project was that:
Choose one answer.
a. we have far more genes than anyone every thought.
b. bacteria have more genes than we do.
c. our genome doesn't resemble those of other mammals at all.
d. we have fewer genes than scientists had predicted.
d. we have fewer genes than scientists had predicted.
Semi-conservative DNA replication is possible because:
Choose one answer.
a. one DNA polymerase molecule can synthesize two DNA strands at once.
b. each cell needs only half as much DNA as its parent cell.
c. transcription uses only the template strand, not the gene strand.
d. one strand has all the information needed to specify a complementary strand.
d. one strand has all the information needed to specify a complementary strand.
The fact that the genetic code is triplet in nature means:
Choose one answer.
a. each nucleotide is read three times.
b. each amino acid is coded for by three codons.
c. codons each consist of three nucleotides.
d. each codon codes for three amino acids.
e. none of these answers are correct.
c. codons each consist of three nucleotides.
The semi-conservative nature of DNA replication results in:
Choose one answer.
a. two completely new DNA strands copied from one old strand.
b. the old DNA being destroyed after replication.
c. two new strands of DNA each paired with one of the old.
d. a reduction of information before cell division.
c. two new strands of DNA each paired with one of the old.
f a species' DNA contains 30% C (cytosine), what is the percentage of A (adenine) in the DNA?

Choose one answer.
a. 25%
b. 60%
c. 20%
d. 30%
e. 80%
20
When DNA is replicated the molecule is first split apart by the action of:
Choose one answer.
a. rRNA.
b. mRNA.
c. an enzyme.
d. tRNA.
c. an enzyme.
Which is NOT one of the events that occur in DNA replication?
Choose one answer.
a. The double strand of DNA opens up into two single strands.
b. Adenine (A) pairs with thymine (T).
c. The old strand of DNA is broken down after being replicated.
d. The entire DNA molecule is replicated.
c. The old strand of DNA is broken down after being replicated.
Which is true about RNA compared to DNA?
Choose one answer.
a. RNA is used to make proteins; DNA is used to make RNA.
b. RNA is double stranded; DNA is single stranded.
c. RNA is found only in the cytoplasm; DNA is found only in the nucleus.
d. RNA has three building blocks; DNA has four.
d. RNA has three building blocks; DNA has four.
Which of the following is a molecule that serves as a building block of DNA molecules and is the basis of genetic information?
Choose one answer.
a. chromosome
b. enzyme
c. gene
d. nucleotide
d. nucleotide
Which sequence is ordered from the least to greatest information content?
Choose one answer.
a. nucleotide, genome, chromosome, gene
b. nucleotide, gene, chromosome, genome
c. genome, chromosome, gene, nucleotide
d. nucleotide, gene, genome, chromosome
b. nucleotide, gene, chromosome, genome
Which would be identical in the nuclei of living cells of both the leaf and the root of the same plant?
Choose one answer.
a. DNA
b. enzymes
c. proteins
d. mRNA
a. DNA
A chemical that destroys ribosome functioning would most IMMEDIATELY affect:
Choose one answer.
a. translation.
b. respiration.
c. DNA replication.
d. transcription.
a. translation
A codon is a sequence of three:
Choose one answer.
a. sugars.
b. proteins.
c. nitrogenous bases.
d. amino acids.
c. nitrogenous bases.
A gene is expressed when it:
Choose one answer.
a. is transcribed into RNA, then translated into a protein.
b. is transcribed into an enzyme that catalyzes a chemical reaction.
c. moves into the cytoplasm and directs a metabolic event.
d. is translated into a hormone.
a. is transcribed into RNA, then translated into a protein.
A molecule that directs cell processes by serving as a catalyst for reactions is a or an:
Choose one answer.
a. nucleotide
b. gene
c. enzyme
d. chromosome
c. enzyme
A protein:
Choose one answer.
a. is formed from sugars and lipids.
b. is a unit of condensed glycerol and fatty acids.
c. contains phosphates, sugars and nitrogenous bases.
d. is a chain of amino acids.
d. is a chain of amino acids.
A ribosome is the cell organelle upon which (the) _______ occurs.
Choose one answer.
a. protein synthesis
b. production of messenger RNA
c. production of transfer RNA
d. synthesis of amino acids
a. protein synthesis
A substance that blocks transcription immediately stops which?
Choose one answer.
a. production of mRNA
b. processing of mRNA
c. attachment of a substrate to an enzyme
d. attachment of tRNA to amino acid
a. production of mRNA
Amino acids are transported to the site of protein synthesis by _______ molecules.
Choose one answer.
a. transfer RNA
b. RNA
c. DNA
d. ribosomal RNA
a. transfer RNA
Arrange the following in the order that they occur during the process of going from the bases to a trait.
1. protein
2. gene
3. transfer RNA
4. messenger RNA
5. amino acid
Choose one answer.
a. 2, 3, 4, 1, 5
b. 1, 2, 4, 3, 5
c. 1, 5, 3, 4, 2
d. 2, 4, 3, 5, 1
d. 2, 4, 3, 5, 1
At the ribosomes ___________ and ___________ come together, enabling the synthesis of ____________.
Choose one answer.
a. nucleotides / DNA / mRNA
b. protein / RNA nucleotides / tRNA
c. mRNA / tRNA / proteins
d. amino acids / nucleotides / DNA
c. mRNA / tRNA / proteins
Below is the template strand of an expressed segment of a DNA molecule. Which mRNA would this sequence specify?
TACGCCAGTGCTATCGATATT
Choose one answer.
a. TACGCCAGTGCTATCGATATT
b. UACGCCAGUGCUAUCGAUAUU
c. AUGCGGUCACGAUAGCUAUAA
d. ATGCGGTCACGATAGCTATAA
c. AUGCGGUCACGAUAGCUAUAA
Each could inhibit protein synthesis EXCEPT:
Choose one answer.
a. making the nuclear membrane impermeable to RNA.
b. missing an essential amino acid from your diet.
c. lacking enough grams of protein per day.
d. a diet containing too much of a non-essential amino acid.
d. a diet containing too much of a non-essential amino acid.
Each sequence of nucleotide bases within one gene contains the information for a sequence of which make up one .
Choose one answer.
a. substrates / product
b. tRNA / mRNA
c. amino acids / protein
d. proteins / enzyme
c. amino acids / protein
Enzymes are important compounds in a plant because they:
Choose one answer.
a. speed up chemical reactions.
b. move throughout the plant and control the development of each tissue.
c. contain the code for protein synthesis.
d. transmit genetic information from one generation to the next.
a. speed up chemical reactions.
For a codon sequence of nucleotide bases AUC, the template or transcribed DNA will have the sequence ___________and the anticodon the sequence ___________.
Choose one answer.
a. TAG / UAG
b. ATC / ATC
c. ATC / UAG
d. UAG / TAG
a. TAG / UAG
Having _________ gives proteins quaternary structure.
Choose one answer.
a. coils with folds
b. several polypeptides associated with one another
c. folded sheets
d. linear chains
b. several polypeptides associated with one another
How many base pairs in a gene are required to encode a protein of 60 amino acids (not including the stop codon)?
Choose one answer.
a. 120
b. 30
c. 60
d. 180
d. 180
In plants, the process of translation occurs:
Choose one answer.
a. on the cell membrane.
b. in the nucleus.
c. on the ribosomes.
d. in the mitochondria.
c. on the ribosomes.
Marks: 1
In translation, the tRNA anticodon ACC is complementary to:
Choose one answer.
a. the stop sequence, UGA.
b. the rRNA anticodon, UGG.
c. the DNA template sequence, UGG.
d. the mRNA codon, UGG.
b. the rRNA anticodon, UGG.
Not all proteins have:
Choose one answer.
a. quaternary structure.
b. peptide bonds.
c. primary structure.
d. amino acids.
a. quaternary structure.
Nucleotides containing ________ are NOT used when DNA is replicated.
Choose one answer.
a. thymine (T)
b. adenine (A)
c. uracil (U)
d. cytosine (C)
c. uracil (U)
Place in order the steps involved in the activation of a gene resulting in the expression of a phenotype.
1. mRNA -> protein 4. internal receptor
2. DNA -> mRNA 5. protein catalyzes reaction
3. external environmental stimulus 6. phenotype expressed

Choose one answer.
a. 3, 4, 2, 1, 5, 6
b. 3, 4, 5, 6, 2, 4
c. 6, 2, 1, 3, 4, 5
d. 4, 3, 2, 1, 5, 6
3, 4, 2, 1, 5, 6
Preliminary to the process of transcription in the nucleus, the two halves of a segment of DNA are split apart (or unzipped) by the action of:
Choose one answer.
a. an enzyme.
b. a nucleotide.
c. messenger RNA.
d. an amino acid
an enzyme.
Replacing one amino acid in a protein molecule with a different amino acid will:
Choose one answer.
a. never change the activity of the protein molecule.
b. result in the protein molecule becoming denatured.
c. always change the activity of the protein molecule.
d. sometimes improve the activity of the protein molecule.
d. sometimes improve the activity of the protein molecule.
RNA molecules are shorter than DNA molecules because:
Choose one answer.
a. RNA replication is liberal, but DNA replication is semi-conservative
b. RNAs don't last very long inside the cell.
c. RNA is harder to synthesize in long lengths.
d. RNA molecules represent small portions of chromosomes
d. RNA molecules represent small portions of chromosomes
Synthesis of a specific protein would be prevented if:
Choose one answer.
a. there is a lack of amino acids in the cytoplasm.
b. following transcription the resulting mRNA is an exact complement of the DNA segment.
c. the newly made mRNA leaves the cell nucleus.
d. hydrogen bonds holding the DNA together break.
a. there is a lack of amino acids in the cytoplasm.
The allele that controls the production of red pigment in the petals of some flowers does so by causing the production of a or (an) ________ that catalyzes the production of the pigment.
Choose one answer.
a. amino acid
b. ribosome
c. nucleotide
d. enzyme
d. enzyme
The assembly of amino acids into protein molecules takes place and is called .
Choose one answer.
a. at the ribosomes / translation
b. in the nucleus / translation
c. in the nucleus / transcription
d. at the ribosomes / transcription
a. at the ribosomes / translation
The fact that the genetic code is triplet in nature means:
Choose one answer.
a. codons each consist of three nucleotides.
b. each amino acid is coded for by three codons.
c. each codon codes for three amino acids.
d. each nucleotide is read three times.
. codons each consist of three nucleotides.
The genetic code that determines the kinds of amino acids in proteins consists of sequences of ____ bases.
Choose one answer.
a. 5
b. 6
c. 3
d. 2
3
The process of gene expression begins with the synthesis of mRNA. This process is called and takes place in the of plant cells.
Choose one answer.
a. translation / nuclei
b. translation / cytoplasm
c. transcription / cytoplasm
d. transcription / nuclei
d. transcription / nuclei
The process of transcription results in the formation of which type of molecule?
Choose one answer.
a. an amino acid
b. a DNA
c. an RNA
d. a polypeptide
c. an RNA
The secondary structure of a protein molecule is described by the:
Choose one answer.
a. helical coiling of the molecule.
b. combination of two or more protein molecules.
c. folding of the molecule.
d. specific sequence of amino acids.
a. helical coiling of the molecule.
The tRNA carrying tryptophan has the anticodon ACC. What is the codon on the mRNA to which the tRNA will attach?

Choose one answer.
a. CCA
b. ACC
c. UGG
d. TGG
ugg
he ___________ transports individual amino acids which are assembled into proteins according to the codon sequence in the__________ .
Choose one answer.
a. tRNA / DNA
b. mRNA / DNA
c. mRNA / rRNA
d. tRNA / mRNA
d. tRNA / mRNA
This semester we covered protein synthesis in detail because:
Choose one answer.
a. proteins are the genetic code of the chromosomes.
b. the information in genomes is expressed in the form of proteins.
c. proteins are genes.
d. proteins make up the codons of RNA.
b. the information in genomes is expressed in the form of proteins.
Transcription results in ______ synthesis whereas translation results in _____ synthesis.
Choose one answer.
a. DNA / RNA
b. RNA / DNA
c. RNA / protein
d. DNA / protein
c. RNA / protein
What do DNA replication, transcription and translation have in common?
Choose one answer.
a. All rely on base-pairing.
b. All use mRNA.
c. All occur only in dividing cells.
d. All occur in the nucleus.
a. All rely on base-pairing
What is the specific location for synthesis of the enzyme amylase in a plant cell?
Choose one answer.
a. nucleus
b. mitochondria
c. ribosome
d. starch grains
c. ribosome
What would be the correct template strand and mRNA transcribed from a DNA molecule with the following gene strand: ACATTAG. (The following pairs are TEMPLATE DNA / mRNA.)
Choose one answer.
a. UGUAAUC / UCUAAUG
b. TGTAATC / ACATTAG
c. ACATTAG / UGUAAUC
d. TGTAATC / ACAUUAG
TGTAATC / ACAUUAG
What would be the fewest number of bases in a gene that codes for the production of a protein 60 amino acids in length?
Choose one answer.
a. 180
b. 60
c. 30
d. 120
180
When a gene is expressed, the process of translation takes place ___________ and results in the production of ___________.
Choose one answer.
a. at a ribosome / a protein molecule
b. in the nucleus / an enzyme molecule
c. at a ribosome / an mRNA molecule
d. in the nucleus / an mRNA molecule
at a ribosome / a protein molecule
Where does translation take place?
Choose one answer.
a. starch grains
b. nucleus
c. ribosome
d. mitochondria
ribosome
Which DNA molecule would encode the same polypeptide as that encoded by the following messenger RNA? (The second series of letters would be immediately below the first set.)

UCUGCUACA (mRNA)
Choose one answer.
a. B . UCUGCUACA AGACGAUGU
b. TGTAGCAGA ACATCGTCT
c. AGACCATGT TCTGGTACA
d. AGTGCGACT TCACGCTGA
AGTGCGACT TCACGCTGA
Which is an INCORRECT comparison of DNA replication to transcription?
Choose one answer.
a. A pairs with T in DNA replication but A pairs with U in transcription.
b. Both strands of DNA are copied in replication, only all of one strand of DNA is used in transcription.
c. Mistakes in DNA replication can eventually lead to mistakes in transcription.
d. Replication occurs in the nucleus; transcription occurs in the cytoplasm.
Replication occurs in the nucleus; transcription occurs in the cytoplasm.
Which of the following best sums up the role of ribosomes?
Choose one answer.
a. mRNA --> protein
b. mRNA --> DNA
c. tRNA --> rRNA
d. mRNA (nucleus) --> mRNA (cytoplasm)
a. mRNA --> protein
Which of the following is NOT needed in the process of translation?
Choose one answer.
a. ribosomes
b. DNA
c. messenger RNA
d. transfer RNA
b. DNA
Which processes involve messenger RNA, transfer RNA, amino acids, and ribosomes?
Choose one answer.
a. transcription
b. meiosis
c. translation
d. DNA replication
translation
A plasmid is:
Choose one answer.
a. all of the DNA in a bacterium.
b. a small circular piece of DNA in a bacterium.
c. a small section of RNA which becomes linked to bacterial DNA.
d. a section of the main chromosome in a bacterium that has broken off.
all of the DNA in a bacterium.
A scientist attempts an experiment to transform tobacco with DNA from corn. One way to check and see if the tobacco plant has incorporated the DNA is to:
Choose one answer.
a. look for artificial chromosomes in both the corn and tobacco.
b. use DNA ligase to join the sticky ends of the corn and tobacco DNA together.
c. isolate a plasmid from tobacco to check for the insert.
d. use a selectable marker, such as antibiotic resistance, along with the corn DNA.
use a selectable marker, such as antibiotic resistance, along with the corn DNA.
Agrobacterium tumefaciens has been useful in plant genetic engineering because it:
Choose one answer.
a. causes tumors and has therefore provided clues for curing cancer in plants.
b. only changes the genotype but never the phenotype of plants it infects.
c. naturally transfers its own DNA to the plant cells that it infects.
d. is a plasmid that naturally occurs in the nuclei of plant cells.
naturally transfers its own DNA to the plant cells that it infects.
Compared to biotechnological approaches, one of the major disadvantages of using traditional methods of plant breeding is that:
Choose one answer.
a. only individual genes can be manipulated by traditional breeding.
b. nutritional characteristics cannot be manipulated by traditional breeding.
c. breeders cannot rely on sexual reproduction of plants.
d. the process of traditional breeding is very slow.
the process of traditional breeding is very slow. Correct
For recombinant DNA techniques to be successful which of the following must occur?
Choose one answer.
a. The foreign DNA inserted must be transcribed and translated into a protein by the host cell.
b. The original genetic information of the host must be removed from the host cell.
c. Messenger RNA must be inserted in addition to DNA.
d. The inserted DNA must be from the same species as the host DNA.
The foreign DNA inserted must be transcribed and translated into a protein by the host cell.
How is genetic engineering the same as traditional breeding methods?
Choose one answer.
a. Both take a long time to produce desired phenotypes.
b. Both guarantee the desired genetic result.
c. Both result in a change in the genetic information.
d. Both combine information from unrelated organisms.
Both result in a change in the genetic information.
If an organism has been genetically transformed, then:
Choose one answer.
a. its genome has a lot of mutations.
b. a researcher has stably incorporated new DNA into it.
c. it is resistant to antibiotics.
d. it has evolved into an entirely new species.
a researcher has stably incorporated new DNA into it.
n order to carry out recombinant DNA experiments, one at least needs:
Choose one answer.
a. restriction enzymes, DNA ligase and plasmids.
b. DNA polymerase, RNA polymerase, and tRNAs.
c. rRNA, mRNA, and tRNA.
d. DNA, RNA, and protein.
restriction enzymes, DNA ligase and plasmids
In order to stably introduce a gene from a bacterium into corn, one might:
Choose one answer.
a. isolate the gene with restriction enzymes and use the DNA gun to introduce it into corn.
b. dip the corn flowers in a suspension made from a dried bacterial culture.
c. grow corn for many generations in the habitat to which the bacteria are adapted.
d. treat the corn with hormones to soften its cell walls for entry of Agrobacterium tumefaciens.
isolate the gene with restriction enzymes and use the DNA gun to introduce it into corn.
n plant tissue culture, a callus is:
Choose one answer.
a. unorganized growth of plant cells that form a tumor-like cell mass.
b. a plant cell whose wall has been removed using enzymes.
c. formation of an embryo from individual somatic (non-gametic) cells.
d. a growth on the meristem formed from pushing through the soil.
unorganized growth of plant cells that form a tumor-like cell mass
in recombinant DNA experiments, small DNA fragments are cut out of larger DNA molecules using:
Choose one answer.
a. microscapels.
b. enzymes.
c. DNA ligase.
d. lasers.
. enzymes.
In recombinant DNA experiments, ______ is used to cut pieces of DNA and ______ joins the resulting fragments to form recombinant DNA.
Choose one answer.
a. DNA polymerase / a restriction enzyme
b. a plasmid / DNA ligase
c. a restriction enzyme / DNA ligase
d. DNA ligase / restriction enzyme
a restriction enzyme / DNA ligase
n recombinant DNA techniques the ultimate goal is the introduction of a desired gene from species X to species Y. Which is the proper order of steps to genetically engineer species Y?
1. insert recombinant plasmid into Agrobacterium
2. choose and isolate desired gene
3. produce calluses
4. insert desired gene into plant cell chromosome
5. cut and insert desired gene in plasmid
6. produce adult plant with desired gene
7.identify recombinant plasmid
Choose one answer.
a. 1, 2, 3, 4, 5, 6, 7
b. 1, 7, 2, 4, 3, 6, 5
c. 4, 2, 7, 6, 3, 5, 1
d. 2, 5, 7, 1, 4, 3, 6
. 2, 5, 7, 1, 4, 3, 6
n recombinant DNA, the function of vectors, such as plasmids, is to:
Choose one answer.
a. cut chromosomes at specific sites.
b. move genes into different genomes.
c. produce sticky ends on genes.
d. identify desired genes in bacteria.
. move genes into different genomes.
Intact plants can be regenerated from plant tissue cultures because plant cells are:
Choose one answer.
a. genetically transformed.
b. always dividing.
c. resistant to antibiotics.
d. totipotent.
totipotent.
Modern genetic engineering methods differ from natural or traditional methods of plant breeding in that modern methods:
Choose one answer.
a. move individual genes into a target organism.
b. produce new varieties of existing species.
c. produce organisms with improved characteristics.
d. produce hybrids between species.
move individual genes into a target organism.
One advantage of recombinant DNA technology over traditional methods of plant breeding is that it:
Choose one answer.
a. doesn't require the use of vectors such as Agrobacterium tumefaciens
b. can change the genetic makeup of a crop, but traditional breeding cannot.
c. frees the breeder from ever having to do traditional crossing and selection.
d. can be used to manipulate genes one at a time.
can be used to manipulate genes one at a time.
One benefit to the farmer of using crops modified with herbicide and pesticide resistance is that:
Choose one answer.
a. they eliminate some passes with heavy machinery, reducing soil compaction.
b. the farmer saves money by not having to use any fertilizer or irrigation.
c. seeds are cheaper than conventional hybrids and can be saved every year.
d. reduced biodiversity always lowers the crop
they eliminate some passes with heavy machinery, reducing soil compaction.
One danger of the widespread adoption by farmers of crop varieties genetically engineered to resist herbicides is that:
Choose one answer.
a. farmers will have to increase herbicide dosages to kill the weeds.
b. crop varieties have to be re-engineered every year to maintain resistance.
c. farmers will keep seeds and reduce profit margins of seed companies.
d. weeds will become herbicide-resistant due to repeated use of a single herbicide.
weeds will become herbicide-resistant due to repeated use of a single herbicide.
One of the major disadvantages of using traditional methods of sexual reproduction to breed plants is:
Choose one answer.
a. identical materials can be propagated without the plant finishing its life cycle.
b. individual genes can be manipulated.
c. the process is very slow.
d. complex characteristics can be manipulated all at once.
the process is very slow
One recombinant DNA technique used in transforming a dicot plant requires __________ to transfer specific genes to the nuclei of the recipient plant.
Choose one answer.
a. Agrobacterium tumefaciens
b. cross pollination
c. ribosomes
Agrobacterium tumefaciens
One surprise that came from analyzing the results of the Human Genome Sequencing Project was that:
Choose one answer.
a. we have far more genes than anyone every thought.
b. we have fewer genes than scientists had predicted.
c. our genome doesn't resemble those of other mammals at all.
d. bacteria have more genes than we do.
we have fewer genes than scientists had predicted.
Put the following steps of the transformation of a eudicot plant with a foreign gene using Agrobacterium tumefaciens in the correct sequence.
1) Insert the foreign gene into a plasmid.
2) Transformed plant cells express the foreign gene.
3) Bacterial cells invade plant cells.
4) Foreign DNA is transferred to a plant chromosome.
Choose one answer.
a. 1, 3, 4, 2
b. 3, 2, 1, 4
c. 3, 1, 4, 2
d. 3, 1, 4, 2
a. 1, 3, 4, 2
Recombinant DNA techniques have much in common with the older techniques of selective breeding. Which of the following statements is TRUE of ONLY the newer techniques (but not the older techniques)?
Choose one answer.
a. New genetic combinations are created.
b. New varieties are created.
c. Mass production is fast.
d. Many years of research are required.
Mass production is fast.
Restriction enzymes:
Choose one answer.
a. are present in the epidermis to restrict mineral movement.
b. are used to cut DNA molecules at specific nucleotide sequences.
c. are used to synthesize DNA molecules.
d. digest stored protein in endosperm.
are used to cut DNA molecules at specific nucleotide sequences.
The key characteristic of Agrobacterium tumefaciens that has made it so valuable for plant genetic engineering is that it:
Choose one answer.
a. only infects grasses such as corn and wheat.
b. transfers DNA into its host plant.
c. carries antibiotic resistances.
d. causes the plant genome to fragment into useful sized plasmids.
transfers DNA into its host plant
The 'DNA-gun' can be used to introduce foreign DNA into plant cells by:
Choose one answer.
a. a virus which injects recombinant DNA through the cell membrane.
b. firing DNA-coated microscopic pellets into plant cells at high velocity.
c. the discharge of an slingshot which propels nuclei toward plant cells.
d. bacteria which infect the plant cell.
firing DNA-coated microscopic pellets into plant cells at high velocity
When bacterial cells are transformed with foreign DNA, this DNA often contains an antibiotic-resistance gene to:
Choose one answer.
a. allow selection for those cells which have incorporated the foreign DNA.
b. increase DNA replication.
c. increase the rate of DNA incorporation into chromosomes.
d. prevent the cells from becoming infected with pathogens.
allow selection for those cells which have incorporated the foreign DNA.
When creating recombinant DNA, which is the proper sequence?
Choose one answer.
a. restriction enzyme -> DNA ligase -> sticky ends -> restriction sequence
b. DNA ligase -> sticky ends -> restriction enzyme -> translation
c. DNA ligase -> restriction sequence -> tRNA -> translation
d. restriction enzyme -> restriction sequence -> sticky ends -> DNA ligase
restriction enzyme -> restriction sequence -> sticky ends -> DNA ligase
When plant cells are transformed with foreign DNA, this DNA often contains an antibiotic-resistance gene to:
Choose one answer.
a. increase the rate of DNA incorporation into the plant chromosomes.
b. increase DNA replication.
c. allow selection for those plant cells which have incorporated the foreign DNA.
d. prevent the plant cells from becoming infected with pathogens.
allow selection for those plant cells which have incorporated the foreign DNA
Which best describes a plasmid?
Choose one answer.
a. DNA found in a plant nucleus
b. recombinant DNA
c. strands of DNA
d. small, circular DNA found in bacteria
small, circular DNA found in bacteria
Which is a valuable application of biotechnology?
Choose one answer.
a. plants used as chemical factories
b. increased use of monocultures
c. abandonment of natural resources
d. conflict over gene ownership
plants used as chemical factories
Which is an example of activation tagging in DNA?
Choose one answer.
a. Soybeans with the ability to withstand herbicide applications.
b. Promoter genes inserted into the rice genome that turn on previously unexpressed genes similar to those expressed in corn.
c. Daffodil genes inserted into the rice genome to increase nutritional content.
d. Rice genes shot into corn cells that are expressed in mature corn plants.
b. Promoter genes inserted into the rice genome that turn on previously unexpressed genes similar to those expressed in corn.
Which is an example of recombinant DNA?
Choose one answer.
a. a plasmid consisting of DNA from two different sources
b. a gene that carries a major mutation
c. a genome cut with an endonuclease
d. bacterial genome with plasmid DNA
a plasmid consisting of DNA from two different sources
Which is the correct statement about both selective breeding and recombinant DNA?
Choose one answer.
a. They assure that the desired genes will be expressed.
b. They require little time before results are achieved.
c. They can be used to produce new genetic combinations.
d. You know exactly what the offspring will be.
hey can be used to produce new genetic combinations
Which of the following can be used to move genes in genetic engineering of plants?
Choose one answer.
a. virus and fungi
b. gene gun and plastid
c. gene gun and plasmid
d. bacteria and mitochondria
gene gun and plasmid
Which of the following segments of double-stranded DNA is most likely to be a restriction enzyme recognition site?
Choose one answer.
a. GCTTGC / CGAACG
b. GCATGC / CGTACG
c. AAAAAA / TTTTTT
d. ACGTAC / TGCATG
GCATGC / CGTACG
Which statement best describes transformed plants?
Choose one answer.
a. They are resistant to infection by Agrobacterium tumefaciens.
b. They contain DNA from a different source than themselves.
c. They contain DNA that has undergone a mutation.
d. They incorporate changes in DNA that occur naturally although rarely.
They contain DNA from a different source than themselves.
Which term or phrase describes the ability of a cell to provide information for the development of an entire organism?
Choose one answer.
a. totipotency
b. transgenic
c. universal DNA code
. totipotency
Why does transformation with Agrobacterium tumefaciens work with only a limited number of organisms?
Choose one answer.
a. Animals have cell walls that make infection by A. tumefaciens difficult.
b. A. tumefaciens cannot infect a previously wounded plant.
c. A. tumefaciens is a disease organism of eudicot plants.
d. A. tumefaciens is not commonly found in nature.
A. tumefaciens is a disease organism of eudicot plants.
Why is producing improved plants through recombinant DNA technology considered to be a valuable alternative to traditional methods of crop breeding?
Choose one answer.
a. Recombinant DNA methods for crop improvement do not require that a specific gene be isolated before it can be modified.
b. Genetically engineered plants are always antibiotic resistant.
c. Recombinant DNA methods produce altered crops faster than traditional breeding methods.
d. Recombinant DNA methods cause changes throughout the genome of the crop plant but traditional breeding affects only single, specific genes.
Recombinant DNA methods produce altered crops faster than traditional breeding methods
A useful application of the terminator gene might be its:
Choose one answer.
a. ability to continuously kill invading insects.
b. ability to grow successive generations containing the gene.
c. usefulness for agriculture in developing countries.
d. ability to reduce gene flow between medicinal crops and nearby food crops.
ability to reduce gene flow between medicinal crops and nearby food crops
Among the top concerns associated with the Bt gene is:
Choose one answer.
a. genetic contamination of wild varieties of non-GM corn individuals.
b. development of more herbicide resistant corn.
c. increased biodiversity of corn.
d. complete eradication of the European corn borer.
genetic contamination of wild varieties of non-GM corn individuals
Because corn is ___________, it easily leads to genetic pollution of non-GM corn populations.
Choose one answer.
a. a monocot
b. a food crop around the world
c. monoecious
d. wind pollinated
d. wind pollinated
Boycotting GM crops is difficult for concerned consumers because:
Choose one answer.
a. interest in such movements have been dying out.
b. few cases of toxic effects on humans have been documented.
c. biotechnology companies have kept their products secret.
d. most foods in the US are unlabeled regarding their GM status.
most foods in the US are unlabeled regarding their GM status.
Bt (Bacillus thurengiensis) toxin can potentially be very useful because:
Choose one answer.
a. Bt toxin will not harm insects, only plants.
b. plants can be engineered to produce it and thus become resistant to some herbivores.
c. it is very easy to place its gene into the genome of Agrobacterium tumefaciens.
d. scientists can use it to help eliminate harmful insect species.
plants can be engineered to produce it and thus become resistant to some herbivores
Genetically modifying soybeans so they are resistant to herbicides means that:
Choose one answer.
a. soybeans in the field will not be affected when the field is treated to remove weeds.
b. consumers of Roundup Ready soybean products will better digest their vegetables.
c. they have the potential of becoming "super weeds."
d. there will be no need to chemically treat agricultural field with herbicides.
a. soybeans in the field will not be affected when the field is treated to remove weeds.
How do genes escape from crops into weeds and other plants in the environment?
Choose one answer.
a. The genes move into the soil and are picked up through the roots.
b. They bribe the guard cells.
c. Cross-pollination by pollen from crop plants with nearby wild varieties.
d. Insects feeding on a plant leave genes behind from previous meals.
Cross-pollination by pollen from crop plants with nearby wild varieties
How do herbicide-resistant weeds come about?
Choose one answer.
a. Common weeds are exposed to X-rays leading to mutations conferring super strength.
b. Herbicide resistant genes from crop plants come into the weed population through hybridization.
c. Gene flow of genes conferring strength into common weeds from wild populations of closely related plants leads to the super condition.
d. Scientists genetically modify common weeds leading to the super condition.
. Herbicide resistant genes from crop plants come into the weed population through hybridization. Correct
One benefit to the farmer of using crops modified with herbicide and pesticide resistance is that:
Choose one answer.
a. the farmer saves money by not having to use any fertilizer or irrigation.
b. seeds are cheaper than conventional hybrids and can be saved every year.
c. the crops produce cleaner fields which always reduces soil erosion.
d. they eliminate some passes with heavy machinery, reducing soil compaction.
e. reduced biodiversity always lowers the crop's susceptibility to disease
they eliminate some passes with heavy machinery, reducing soil compaction
One danger of the widespread adoption by farmers of crop varieties genetically engineered to resist herbicides is that:
Choose one answer.
a. farmers will keep seeds and reduce profit margins of seed companies.
b. engineered plants are susceptible to diseases that they otherwise resist.
c. crop varieties have to be re-engineered every year to maintain resistance.
d. resistant weeds are selected by repeated use of a single herbicide.
e. farmers will have to increase herbicide dosages to kill the weeds.
resistant weeds are selected by repeated use of a single herbicide
What is a "terminator gene" and why is it used? When activated,:
Choose one answer.
a. it produces a pesticide that kills feeding insects. This reduces crop loss.
b. the plant dies. This reduces weeds that compete with the crop.
c. it produces a toxin that moves into the soil. This reduces loss from soil insects.
d. it makes seeds sterile. This prevents gene escape.
it makes seeds sterile. This prevents gene escape.
What test is often employed to check for the presence of possible allergens in GM foods?
Choose one answer.
a. toxic response in mice
b. years of clinical studies on patients
c. amino acid sequence
d. nutritional composition
. amino acid sequence
Which is a valuable application of biotechnology?
Choose one answer.
a. conflict over gene ownership
b. plants used as vaccine delivery
c. increased chemical use
d. increased use of monocultures
. plants used as vaccine delivery
Which of the following is a goal that has been reached by the use of biotechnology?
Choose one answer.
a. Crop plants have been made with resistance to some diseases.
b. Biotechnology in developing countries is affordable.
c. New products have broken our dependence on pesticide use in agriculture.
d. Gene flow between crops and weeds has been successful.
Crop plants have been made with resistance to some diseases.
Which of the following is a practice instituted to delay the evolution of resistance in pest populations to pesticide produced by transgenic crops?
Choose one answer.
a. Fine farmers who save seeds to use in the future.
b. Design crop plants so that the pesticide produced targets a narrower group of pests.
c. Mandate a genetic refuge of non-GM crops near the GM crop.
d. Mandate restrictions against growing GMOs near wild relative
Mandate a genetic refuge of non-GM crops near the GM crop.
Which statement about the use of genetically engineered crop plants is TRUE?
Choose one answer.
a. There is a no risk that marker genes, such as antibiotic resistance, will move into soil bacteria.
b. The demand for crop plants in developing nations is high and is influencing the type of plants being produced through genetic engineering.
c. Research has shown gene escape from crop plants to wild relatives does not happen.
d. Gene escape from engineered crop plants is primarily through vegetative propagation.
The demand for crop plants in developing nations is high and is influencing the type of plants being produced through genetic engineering
Which statement could you use to argue in favor of GM crops?
Choose one answer.
a. GM food products are clearly labeled to allow consumers to avoid them.
b. There is no evidence that genes have moved from GM plants to non-GM plants.
c. People in Europe have found GM foods to be safe.
d. People in the U.S. have been consuming them for years with no apparent problems.
People in the U.S. have been consuming them for years with no apparent problems
Why has the Bt gene been inserted into several crop plants?
Choose one answer.
a. It increases the nutritional value of the crop.
b. It gives the plant resistance to a viral disease.
c. It makes the crop herbicide-resistant.
d. It kills the caterpillars that eat the crop.
It kills the caterpillars that eat the crop.
With the use of bioengineered crop plants, resistant pest populations become a real possibility. Which of the following is a techniques used to reduce the affect of resistant pest populations?

Choose one answer.
a. Decreasing the use of chemical pesticides
b. Growing crops in a region with many weedy relatives
c. Using antibiotic markers to track escapes
d. Establishing crop genetic refuge populations
e. Increasing the use of monocultures
Establishing crop genetic refuge populations
A disadvantage of using algae as a biofuel is:
Choose one answer.
a. it doesn't work as a biofuel.
b. technology is still being developed.
c. competition with foodstock plants for arable land.
d. a negative impact on fresh water resources.
e. a very low yield/acre compared to second generation biofuels.
b. technology is still being developed.
A major difficulty in the production of cellulosic ethanol is:
Choose one answer.
a. it can't be blended with gasoline.
b. a lack of plant material that can be used in the process.
c. transforming sugar to starch.
d. breaking down the cell wall to products ready for respiration.
e. the flammability of ethanol.
breaking down the cell wall to products ready for respiration
A new technological challenge in the production of cellulosic ethanol is:
Choose one answer.
a. the explosive flammability of lignin.
b. improving the efficiency of breaking down cell walls.
c. finding feedstock species that grow outside the tropics.
d. finding a way to transform sugar into starch.
e. to synthesize it to have more energy than gasoline.
improving the efficiency of breaking down cell walls
An advantage to using perennial grasses for biofuel feedstocks is:
Choose one answer.
a. they are harvested just like corn and soybeans.
b. they aren't as tall and cumbersome as biodiesel crops.
c. they can only be grown by family farmers, not by corporations.
d. less soil carbon is released because plowing is reduced.
e. they require no fertilizer at all.
less soil carbon is released because plowing is reduced
Biodiesel can be made from:
Choose one answer.
a. corn stover, switchgrass, and miscanthus.
b. waste vegetable oil, soy beans, and palm oil.
c. cellulosics, sugar cane bagasse, and soy beans.
d. corn kernels, hybrid poplar, and algae.
e. waste rubber, switchgrass, and jojoba.
waste vegetable oil, soy beans, and palm oil.
Cellulose is a major component of:
Choose one answer.
a. DNA.
b. lipids and fats.
c. plant membranes.
d. plant cell walls.
plant cell walls.
How are corn stover and sugar cane bagasse similar?
Choose one answer.
a. Both are waste products of crop production.
b. Both are used in the production of biodiesel.
c. Both come from eudicot plants.
d. Neither can be used in the cellulosic process of ethanol production.
e. Both are raw products used in Brazil for ethanol production.
Both are waste products of crop production
Which country listed is the top producer of ethanol in the world?
Choose one answer.
a. Russia
b. France
c. India
d. China
e. Brazil
e. Brazil
Which is FALSE about the use of biofuels?
Choose one answer.
a. Large quantities of water are used in the production of biofuels.
b. Using crops like corn and sugar cane in the biofuel process reduces the acreage put into food production.
c. Biofuel combustion results in better air quality than fossil fuel combustion.
d. Cultivation of crops for biodiesel production may lead to a loss of biodiversity.
e. Annual biofuel crop production emits fewer greenhouse gases than perennial biofuel crop production.
Annual biofuel crop production emits fewer greenhouse gases than perennial biofuel crop production.
Which plant yields the most energy?
Choose one answer.
a. sugar cane
b. corn
c. sugar beets
d. soybeans
e. switchgrass
e. switchgrass
Which two processes that we have studied this year are important to the production of biofuels?
Choose one answer.
a. enzymatic activity and anaerobic respiration
b. climate change and nutrient cycling
c. photosynthesis and irrigation
d. anaerobic respiration and decomposition
e. genetic engineering and fertilizer use
. enzymatic activity and anaerobic respiration
At 30o latitude, one would expect southern Florida to be a desert. Why is that NOT the case?
Choose one answer.
a. Canals bring water to the Sea of Grass.
b. Ocean currents bring in moisture.
c. Warm, dry air currents are descending.
d. It is on the front side of a rain shadow.
e. Water from Lake Okeechobee is used for irrigation.
b. Ocean currents bring in moisture.
Clearing of the rain forest areas of the world is predicted by some experts to result in the gradual warming of the earth because of the production of ________ by the processes of ________ and __________.
Choose one answer.
a. oxygen / combustion / decomposition
b. carbon dioxide / photosynthesis / decomposition
c. carbon dioxide / decomposition / combustion
d. oxygen / respiration / combustion
e. oxygen / photosynthesis / decomposition
carbon dioxide / decomposition / combustion
Climate results from the combined effect of several physical laws. Which 'law' is stated INCORRECTLY?
Choose one answer.
a. Water changes temperature more quickly than land.
b. Hot air rises.
c. As air rises, it contracts and cools.
d. Air picks up moisture as it moves over water.
e. Hot air holds more moisture than cold air.
Water changes temperature more quickly than land
Developed countries produce more carbon dioxide than developing countries.

One solution that might reduce carbon dioxide in the atmosphere allows developed countries to subsidize fuel efficient industrial development in developing countries. This solution is called:
Choose one answer.
a. carbon trading.
b. alternative respiration.
c. a waste of time.
d. a carbon sink.
e. carbon sequestering.
. carbon trading.
Heavy precipitation typical of tropical rainforests is the result of:
Choose one answer.
a. air masses moving off (away) from land.
b. rising air masses that cool and release moisture.
c. ocean currents upwelling from the deep.
d. descending air masses that can no longer hold precipitation.
e. recurring El Nino effects.
rising air masses that cool and release moisture.
If the Earth's axis was not tilted at 23.5o, but was perpendicular to the plane of its path around the sun, then:
Choose one answer.
a. succession would cease to occur.
b. weather would be constant from season to season.
c. tropical rain forests would occur in Canada.
d. the polar ice caps would melt.
e. the rain shadow effect would cease to occur.
weather would be constant from season to season.
It has been predicted that fossil fuel consumption and deforestation of the tropics will result in a change in our atmosphere and an increase in mean global temperatures. Predict the most likely consequence of this warming.
Choose one answer.
a. Temperature forests would expand toward the equator.
b. change in temperature alone will have no effect on plant distribution.
c. Tropical forests would be replaced by grasslands.
d. Tundra would diminish in geographical area.
e. Species diversity would be increased in all communities.
Tundra would diminish in geographical area.
Many ecologists fear that CO2 added to the atmosphere will cause a rise in world wide temperatures because of the greenhouse effect. Some of this CO2 is produced in tropical rainforests by which?
1. respiration by decomposers
2. burning of trees by people
3. photosynthesis by plants
4. succession
5. gross primary productivity
Choose one answer.
a. 3 and 5
b. 1 and 2
c. 2 and 4
d. 1 and 5
e. 3 and 4
1 &2
Of the human alterations on a global scale, which has had largest overall change?
Choose one answer.
a. increase in soil and water nitrogen level
b. bird species extinctions
c. increase in atmospheric carbon dioxide
d. exotic plant invasions
e. land transformation through urbanization and agriculture
land transformation through urbanization and agriculture
Plants may help reduce global warming by:
Choose one answer.
a. removing CO2 from the atmosphere through respiration.
b. shading the earth with their lives.
c. emitting CO2 into the atmosphere through respiration.
d. emitting O2 into the atmosphere through respiration.
e. removing CO2 from the atmosphere through photosynthesis.
removing CO2 from the atmosphere through photosynthesis
temperatures are cooler at the North pole than at the equator.

Which of the following does NOT contribute to this pattern?
Choose one answer.
a. Energy from the sun is spread over a larger area at the North pole.
b. Sunlight passes through more of the atmosphere at the North pole
c. There is less rainfall at the North pole.
d. The Earth is round.
e. The sun's rays strike the surface of the Earth at different angles around the globe.
There is less rainfall at the North pole.
The 23.5o tilt of the earth's axis relative to the sun has what effect on the earth?
Choose one answer.
a. Causes rainforests at the equator.
b. Results in the seasons.
c. Creates a pole-to-equator pattern of air movement.
d. Causes air flow to change from north-south to east-west.
e. Causes both poles to experience continual sunlight throughout the year.
Results in the seasons
The Greenhouse Effect caused by an increase of CO2 in the atmosphere could be of MOST BENEFIT to which plant process?
Choose one answer.
a. osmosis
b. protein synthesis
c. transpiration
d. etiolation
e. photosynthesis
. photosynthesi
The Greenhouse Effect results from:
Choose one answer.
a. increasing level of CO2 in the atmosphere as a result of tropical deforestation and burning of fossil fuels.
b. a decrease in the atmospheric CO2 that reflects light to earth.
c. increasing day length and light intensity because of decreasing global C. vegetation.
d. an increase in atmospheric O2 that transmits light but re-radiates heat.
e. a disruption of the water cycle.
increasing level of CO2 in the atmosphere as a result of tropical deforestation and burning of fossil fuels.
The heat that builds up in the Greenhouse Effect initially enters the atmosphere as:
Choose one answer.
a. carbon dioxide.
b. pollution.
c. ozone.
d. heat.
e. solar radiation.
. solar radiation.
The temperature rise caused by global warming will likely cause a melting of permafrost and a subsequent decline of species diversity in some tundra in Alaska. This is an example of plant populations being affected by a change in:
Choose one answer.
a. species density.
b. humidity.
c. photoperiodicity.
d. seasonality.
e. climate.
species density.
The two most important factors that determine a biome's plant and animal life are:
Choose one answer.
a. elevation and soil type.
b. predominance of trees vs. grasses.
c. temperature and precipitation.
d. proximity of mountains and oceans.
e. distance from equator and daylength.
temperature and precipitation
There has been much concern expressed in the popular media that the destruction of forests will lead to a global warming trend. This concern is based in the reasoning that ________ will cause a warming of the atmosphere.
Choose one answer.
a. oxygen (O2) produced by the burning and decomposition of trees
b. heat produced by the burning of trees
c. heat produced by a population explosion of decomposing organisms
d. carbon dioxide (CO2) produced by the burning and decomposition of trees
e. smoke and particulates produced block the sun
carbon dioxide (CO2) produced by the burning and decomposition of trees
Which biome will be affected the least by global warming?
Choose one answer.
a. taiga
b. temperate grasslands
c. tropical rainforest
d. tundra
e. deciduous forests
. tropical rainforest
Which general climatic conditions are necessary for the perpetuation of a tropical rainforest?
Choose one answer.
a. cold, dry, rising air masses
b. warm, moist, rising air masses
c. cold, dry, descending air masses
d. warm, dry, descending air masses
e. cold, moist descending air masses
warm, moist, rising air masses
Which is a NOT significant source of methane emissions?
Choose one answer.
a. waste lagoons
b. rice paddies
c. landfills
d. nitrogen fertilizers
e. cattle
nitrogen fertilizers
Which is NOT a way to reduce global warming?
Choose one answer.
a. Plant fewer trees.
b. Bury carbon dioxide in deep wells.
c. Produce less waste.
d. Raise fewer cattle.
e. Shoot reflective particles into the atmosphere
Plant fewer tree
Which of the following is a predicted effect of global warming in Illinois?
Choose one answer.
a. river levels rising flooding crops
b. irrigated corn crops in central Illinois
c. giant anacondas in southern Illinois rivers
d. Lake Michigan will dry up
irrigated corn crops in central Illinois
Which of the following statements about climate change is true?
Choose one answer.
a. The existence of a greenhouse effect is controversial among scientists.
b. Carbon dioxide is the only greenhouse gas put into the atmosphere by human activity.
c. Global Climate Change is a conspiracy by environmentalist. It does not exist.
d. If glaciers and ice sheets melt, much of the melt water will go into the oceans causing sea levels to rise.
e. If humans had not interfered with nature by building industrial societies, global climate would not have changed significantly.
If glaciers and ice sheets melt, much of the melt water will go into the oceans causing sea levels to rise
Which of the following would NOT contribute to global warming?
Choose one answer.
a. Increased deforestation within the United States.
b. Increased photosynthesis by plants.
c. Increased respiration by all organisms on the planet.
d. Increased decomposition of organic material by bacteria.
e. Increased production and use of automobiles.
Increased photosynthesis by plants.
Which process is responsible for an increase in the world-wide atmospheric CO2 concentration?
Choose one answer.
a. protein synthesis
b. soil salinization
c. fossil fuel combustion
d. soil erosion
e. acid rain
fossil fuel combustion
Why do most deserts lie at 30 degrees north and south latitude?
Choose one answer.
a. The sun's rays are most intense at these latitudes.
b. The soil at these latitudes does not retain water.
c. Warm, moist air rises at these latitudes resulting in little rain.
d. The air does not move at these latitudes.
e. Dry air descends at these latitudes resulting in little rain.
Dry air descends at these latitudes resulting in little rain
According to the "Tragedy of the Commons,":

Choose one answer.
a. biomagnification of pollution will result in common death.
b. property held communally will always be degraded.
c. government acquisition of parkland reduces available real estate.
d. common people are more exposed to toxic waste than others.
b. property held communally will always be degraded.
An important ecological service that forests perform is that they:
Choose one answer.
a. act as a huge sink for carbon.
b. increase the planet's albedo.
c. shade the ground and keep weeds down.
d. detoxify greenhouse gases.
ct as a huge sink for carbon.
How does the GDP differ from the GPI in measuring wealth?
Choose one answer.
a. The GPI includes the cost of unpaid labor.
b. The GDP takes into account external costs.
c. The GPI takes into account only internal costs.
d. The GDP includes the cost of distributional inequality.
The GPI includes the cost of unpaid labor.
The success of the Yasuni-ITT:
Choose one answer.
a. is dependent on the movement of indigenous populations to cities.
b. is dependent on global support.
c. relies on international corporation commitments.
d. is dependent on removal of its underground oil reserves
is dependent on global support. Correct
Which is an example of a tragedy of a commons?
Choose one answer.
a. legislation of catch limits to avoid depletion of fish stocks in a shared lake
b. depletion of an aquifer by regional farmers
c. destruction of landscape by surface mining on private land
d. selective harvesting of trees by a timber company in a national forest
. depletion of an aquifer by regional farmers
Which of the following is an example of an ecological service?
Choose one answer.
a. a concession stand at a national park
b. garbage pickup by municipal employees
c. guide maps to a protected natural area
d. water purification by soil bacteria
water purification by soil bacteria
Which of the following is an example of an external cost?
Choose one answer.
a. energy used to pump water for irrigation
b. labor used to clear land for building apartments
c. procurement of the copper used in water pipes
d. disposal of packaging used to facilitate shipment
disposal of packaging used to facilitate shipment
Which of the following is an intangible resource?
Choose one answer.
a. genetic diversity
b. sense of place
c. clean water
d. timber
b. sense of place
Which of the following is part of a sustainable society?
Choose one answer.
a. valuing based on neoclassical economics
b. biofuel production instead of food production
c. communal resource sharing
d. clearing land for new housing
communal resource sharing
landscape with a high level of species richness but a low level of species evenness would have:
Choose one answer.
a. very diverse species, but some more abundant than others.
b. some species having plenty to eat and others starving.
c. many different species, but all living in one corner of the landscape.
d. many different species on a very flat terrain.
very diverse species, but some more abundant than others
Biomagnification refers to the increasing:
Choose one answer.
a. level of pollution held in organisms in higher trophic levels.
b. number of invasive species in protected habitats.
c. amount of species richness in tropical habitats.
d. size of organisms at higher trophic levels.
level of pollution held in organisms in higher trophic levels.
Community species diversity depends on all but which factor?
Choose one answer.
a. number of decomposers
b. relative isolation
c. keystone species
d. amount of stress
number of decomposers
Kudzu, an introduced plant in North America, is invasive because it:
Choose one answer.
a. is not adaptable to the ecosystem.
b. has few natural population control mechanisms.
c. grows too slowly to be useful for erosion control.
d. has such a limited range.
has few natural population control mechanisms.
Significant global biodiversity loss can best be correlated with:
Choose one answer.
a. habitat destruction.
b. natural disasters such as earthquakes and hurricanes.
c. production of genetically modified crops.
d. conservation efforts.
habitat destruction.
Species biodiversity alone does not provide an adequate accounting of a community's true biodiversity because it ignores:
Choose one answer.
a. the extinct species in the community.
b. the genetic and ecological biodiversity of the community.
c. the age structure of the community's species.
d. the climate in the community's habitat
the genetic and ecological biodiversity of the community.
Species diversity is higher in the desert community when the saguaro cactus is present. The term for this is:

Choose one answer.
a. super competitor.
b. flagship species.
c. keystone species.
d. metabolism.
e. invasive species.
c. keystone species.
The 6th and latest mass extinction is considered to be caused by:
Choose one answer.
a. increasing radiation penetrating the atmosphere.
b. glaciers pushing in from Canada.
c. human activities the world over.
d. an catastrophic meteor impact.
c. human activities the world over.
The Endangered Species Act represents one approach to preserving biodiversity. However, criticism of this approach is that it:
Choose one answer.
a. can ignore species that are not large, attractive or charismatic.
b. protects threatened species only if they are valuable as human food.
c. preserves whole landscapes and ignores the species living there.
d. sometimes backfires by introducing even more invasive species.
a. can ignore species that are not large, attractive or charismatic
The H in the acronym HIPPO related to endangered species refers to:
Choose one answer.
a. harvesting limits.
b. habitat destruction.
c. high human populations.
d. hampered reproduction.
b. habitat destruction. Correct
The key characteristic used to identify a group as a "Biological Species" is:

Choose one answer.
a. physical differences from other groups.
b. its position in the hierarchy of trophic levels.
c. whether it is animal, vegetable or mineral.
d. its reproductive isolation from other groups.
its reproductive isolation from other group
The O in the acronym HIPPO related to endangered species refers to:
Choose one answer.
a. over harvesting
b. over stimulation
c. out of luck
d. oil pollution
a. over harvesting
The wolf is a keystone species in Yellowstone National Park because:
Choose one answer.
a. its population is the largest of all herbivores in the park.
b. through competition for food, foxes have been eliminated from the park. Foxes are key to keeping the forest healthy.
c. though a series of community connections, the wolf population increases species diversity in the park out of proportion to its population size.
d. wolf packs have destroyed the stream habitat, a key ecosystem in the park.
. though a series of community connections, the wolf population increases species diversity in the park out of proportion to its population size. Correct
Which describes a process that holds great promise for giving economic value to biodiversity?
Choose one answer.
a. ecosystem diversity
b. bioprospecting
c. bioengineering
d. species diversity
. bioprospecting
Which is the best example of a flagship species?
Choose one answer.
a. Corpse flower of Cambodia because it catches the public interest in endangered species.
b. The Northern Spotted Owl of the Pacific Northwest because its requirement for undisturbed habitat protected many other species.
c. Wolf of Yellowstone because through its affect on community relationships the ecosystem is healthier.
d. Trillium plant of northern forests because it can be used to easily identify a healthy forest.
Corpse flower of Cambodia because it catches the public interest in endangered species.
Which of the following are places likely to have very high levels of species diversity?
Choose one answer.
a. islands and the tundra
b. savannas and ice caps
c. farms and mountaintops
d. coral reefs and rainforests
coral reefs and rainforests
Which of the following does NOT contribute to the extinction of a species?
Choose one answer.
a. genetic diversity
b. habitat pollution
c. over-harvesting
d. over-population
. genetic diversity
Which of the following is an activity that can protect biodiversity by identifying tangible economic value in it?
Choose one answer.
a. hunting for plants that synthesize useful drugs (bioprospecting)
b. promoting biodiversity by sharing all species with all countries
c. converting wild habitat to commercial developments
d. bioengineering endangered species to become edible by people
hunting for plants that synthesize useful drugs (bioprospecting)
Which of these factor does NOT contribute to the extinction of a species?
Choose one answer.
a. habitat fragmentation
b. introduction of exotic species
c. genetic variability
d. habitat pollution
genetic variability
How does rotational grazing lower grazing impact on grasslands?
Choose one answer.
a. It reduces invasive plant cover and increases native varieties.
b. It leaves less dry, plant material, and therefore reduces fire.
c. It allows vegetation time to recover from grazing.
d. It reduces the input of fertilizer in grazed areas.
It allows vegetation time to recover from grazing.
Those biomes that have the largest percentage protected are:
Choose one answer.
a. in Africa where human populations are less dense.
b. also those with the highest level of biodiversity.
c. the least useful for habitation and agriculture.
d. in the richest countries with many nature preserves.
the least useful for habitation and agriculture
Tropical dry forests are the least impacted forests. In which two countries are the greatest amount of tropical dry forests?
Choose one answer.
a. Brazil and Indonesia
b. Thailand and New Zealand
c. Honduras and Venezuela
d. Kenya and India
Brazil and Indonesia
Where does one find the largest extent of boreal forests?
Choose one answer.
a. Brazil and Kenya
b. South Africa and Chile
c. U.S. and France
d. Canada and Russia
Canada and Russia
Which areas of the world are undergoing the most deforestation?
Choose one answer.
a. Australia and Southeast Asia
b. South America and Africa
c. South America and Western Europe
d. India and China
South America and Africa
Which is a feature of a core area of a bioreserve?
Choose one answer.
a. camping allowed, but not picnic sites
b. some acres rented to individuals for grazing
c. traditional agricultural practiced allowed
d. no roads, but some hiking trails
no roads, but some hiking trails
Which of the following ecosystem types are most impacted by human use?
Choose one answer.
a. tundra and tropical forests
b. tundra and temperate forests
c. deserts and subtropical forests
d. wetlands and deserts
e. tropical forests and grasslands
tropical forests and grasslands
Which of the following is the largest cause of deforestation in developing countries?
Choose one answer.
a. clearing for fuel and agriculture
b. parkland designation
c. urban encroachment
d. soil infertility
clearing for fuel and agriculture
Which statement about the management of endangered species is TRUE?
Choose one answer.
a. When formulating a management plan, it is best to consider the needs of one species at a time.
b. Past management practices have been highly successful with all types of endangered species.
c. The best way to save an endangered species is to completely eliminate contact of the species with humans.
d. The most successful management strategies involve protecting a species and its habitat.
The most successful management strategies involve protecting a species and its habitat
Which type of ecosystem is in the greatest need for protection?
Choose one answer.
a. tundra
b. marine
c. fresh water
d. boreal forest
marine
Wildlife corridors:
Choose one answer.
a. provide an opportunity for gene exchange in geographically separated populations.
b. are an old fashion management practice that have out-lived their usefulness.
c. reduce the effect of overgrazing by moving predators out of parks.
d. lead wildlife into corrals for inspection and tagging.
provide an opportunity for gene exchange in geographically separated population
A conservation (or buffer) strip is:
Choose one answer.
a. a dedicated area where crops are grown to collect seed for next year.
b. an area of vegetation along a waterway that is harvested for hay.
c. an area of temporary vegetation that is tilled in the fall to increase the nutrients in the soil.
d. an area of permanent vegetation to reduces erosion and contaminated runoff from entering a waterway.
an area of permanent vegetation to reduces erosion and contaminated runoff from entering a waterway
An abandoned, idled, or under-utilized industrial and commercial facility where expansion or redevelopment is complicated by real or perceived environmental contamination is called:
Choose one answer.
a. a total loss.
b. a disaster.
c. a brownfield.
d. inevitable.
c. a brownfield
Green building design does NOT include:
Choose one answer.
a. selection of sustainable site.
b. reduction in the number of contractors.
c. efficient use of energy, water and other resource.
d. reduction of waste and pollution.
reduction in the number of contractors.
Phytodegradation is:
Choose one answer.
a. uptake of toxins from groundwater.
b. releasing gases to the atmosphere through the stomates.
c. breakdown of toxins by plant enzymes.
d. sequestering toxins in the vacuole.
c. breakdown of toxins by plant enzymes
Phytoremediation can involve all BUT which?
Choose one answer.
a. depositing toxin from the roots into the soil
b. breakdown of toxins by plant enzymes
c. sequestering toxins in the vacuole
d. releasing gases to the atmosphere through the stomates
depositing toxin from the roots into the soil
Phytoremediation does NOT involve:
Choose one answer.
a. accumulation of toxic substances in leaf and shoot structures.
b. volatilization of some form of the toxic substance from shoots.
c. breakdown of toxic materials to harmless or useful products by plants.
d. destroying soil microbial associations.
d. destroying soil microbial associations.
Phytoremediation has an advantage over microbial approaches to bioremediation in that:
Choose one answer.
a. using bacteria to clean up pollutants just poisons the ground more.
b. some states require that beautification accompany remediation.
c. bacteria are very difficult to grow outside the laboratory.
d. with phytoremediation, polluted soil needn't be moved or disturbed.
with phytoremediation, polluted soil needn't be moved or disturbed.
Rhizofiltration, a type of phytoremediation, involves:
Choose one answer.
a. the removal of toxic substances via stems.
b. filtering water containing toxic compounds through roots.
c. the filtering of toxic substances from the air.
d. removal of toxic compounds from the soil and then release into the atmosphere.
b. filtering water containing toxic compounds through roots
Sedimentation of the Mississippi River:
Choose one answer.
a. is only a problem when it reaches the Gulf of Mexico.
b. can be reduced by maintaining more plants along the bank.
c. increases the clarity of the water.
d. results in a better habitat for fish and zooplankton.
can be reduced by maintaining more plants along the bank.
The areas of a plant cell where toxic compounds can be concentrated are:
Choose one answer.
a. the cell membrane and the chloroplast.
b. the vacuole and the nucleus.
c. the vacuole and the cell wall.
d. the cell membrane and the cell wall.
the vacuole and the cell wall.
The removal of toxic wastes from soils and sediments by green plants is termed:
Choose one answer.
a. crop rotation.
b. municipal waste removal.
c. phytoremediation.
d. mineral fixation.
phytoremediation.
The use of some plants to remove pollutants from the soil, water or air is called:
Choose one answer.
a. restoration.
b. phytoremediation.
c. phytofiltration.
d. phytotransformation.
phytoremediation.
Using plants to remove pollutants rather than traditional methods can be limited by:
Choose one answer.
a. the area and depth of the plant's roots.
b. pollutant removal cannot be monitored.
c. the cost - it is more expensive to use plants.
d. the inability to recover metals once inside the plant.
the area and depth of the plant's roots.
Using rye grass to remove naphthalene from the soil and to break it down to carbon dioxide and water is an example of which?
Choose one answer.
a. phytoremediation
b. plant abuse
c. phytoaccumulation
d. air pollution
a. phytoremediation
Which is NOT a function of 'green roof' technology?
Choose one answer.
a. reducing storm water run off into water systems
b. reducing the 'urban heat island' effect
c. providing storage areas for horticulture equipment.
d. providing a natural area for stress reduction
c. providing storage areas for horticulture equipment.
Which of the following is a common element in ecological restoration that is important to the restoration of the Mississippi Delta?
Choose one answer.
a. selective cutting of mangrove forests
b. introduction of grazing animals
c. removal of stresses such as loss of sediment
d. removal of invasive trees
c. removal of stresses such as loss of sediment
Which of the following is a human activity (or caused by human activities) that increases global productivity?
Choose one answer.
a. reforestation projects
b. expanding pasture lands
c. expansion of malls
d. desertification
a. reforestation projects
Which of the following represents a stress element in ecological restoration that is important to the restoration of prairies?
Choose one answer.
a. removal of invasive trees
b. replanting of native grasses
c. introduction of grazing animals
d. previously altered drainage patterns
d. previously altered drainage patterns
Which of these statements about green roofs is FALSE?
Choose one answer.
a. Green roofs make habitat more available to urban organisms.
b. They provide a place to escape urban stress.
c. Green roofs allow more rainwater to run off buildings.
d. Air quality on green roofs is higher than on traditional roofs.
Green roofs allow more rainwater to run off buildings.
Which of these statements about green roofs is TRUE?
Choose one answer.
a. Green roofs can capture and divert rain water to growing plants.
b. They absorb less energy than traditional roofs.
c. Construction of green roofs is very similar to traditional roofs.
d. Green roofs make habitat less available to urban organisms.
Green roofs can capture and divert rain water to growing plants
A diet that consists of orange juice, toast with jelly, wheat cake, pineapple juice, soyburger, and sunflower seeds will have an energy efficiency of close to:
Choose one answer.
a. 90%.
b. 10%.
c. 75%.
d. 5%.
b. 10%
As an enlightened consumer, which food should you choose for MAXIMUM energy efficiency (putting yourself lowest on the food chain)?
Choose one answer.
a. grain-fed chickens
b. soybean burger
c. tuna
d. yogurt
b. soybean burger
Carrots are ____________ that are modified for ____________.
Choose one answer.
a. roots / water storage
b. tubers / food storage
c. stems / food storage
d. roots / food storage
roots / food storage
Cotyledons are structures high in stored nutrients and are developed from nutrients transferred to the embryo from which structure in the seed?
Choose one answer.
a. ovule
b. ovary wall
c. endosperm
d. seed coat
c. endosperm
Eating the following crops will provide the most balanced nutrition overall?
Choose one answer.
a. peanuts, soybeans, chickpeas
b. cassava, sweet potato, yam
c. wheat, beans, potato
d. rice, millet, sorghum
wheat, beans, potato
How do scientists determine the center of origin for a crop plant?
Choose one answer.
a. Scientists investigate where the crop plant is part of the daily diet of the people.
b. Scientists look for areas of the world with the most genetically diverse wild varieties.
c. Scientists look for wild varieties of the crop plant and check for the most genetic similarities to the crop plant.
d. The scientists look for the areas in the world that produce the greatest quantity of that plant.
. Scientists look for areas of the world with the most genetically diverse wild varieties.
Humans have greatly altered the evolution of crop plants. Which is NOT an example of artificial selection?
Choose one answer.
a. seed size in wheat
b. tuber size in potatoes
c. nutrition content in corn
d. drought resistance in millet
. drought resistance in millet
In domesticating plants for use as food crops, humans have selected for all BUT which characteristic?
Choose one answer.
a. ripening of fruits over a short time span to aid harvesting
b. seeds with internal dormancy mechanism
c. organs with large amounts of stored nutrient
d. loss of seed dispersal mechanisms
seeds with internal dormancy mechanism
In general, humans consume what part of the plants from the grass family?
Choose one answer.
a. stems
b. tubers
c. grains
d. roots
c. grains
In which area of the world did wheat originate?
Choose one answer.
a. Illinois
b. the fertile crescent
c. the tropical rainforest
d. Central America
b. the fertile crescent
Of all the types of plants eaten, which makes up the majority of the world-wide diet?
Choose one answer.
a. pulses
b. nuts
c. grasses
d. potatoes
c. grasses
The 'center of origin' for corn is in the present day:
Choose one answer.
a. Mexico.
b. Iraq.
c. China.
d. Peru.
a. Mexico
The 'center of origin' for sorghum is in the present day:
Choose one answer.
a. Ethiopia.
b. Iraq.
c. Peru.
d. India.
. Ethiopia.
Place the following steps in the correct order for the germination of a seed.
1. Digestion of reserves.
2. Leaves enlarge.
3. Root elongates.
4. Water is imbibed.
5. Shoot emerges.
Choose one answer.
a. 3, 1, 4, 2, 5
b. 4, 1, 3, 5, 2
c. 3, 4, 1, 5, 2
d. 1, 4, 3, 2, 5
e. 4, 3, 1, 2, 5
b. 4, 1, 3, 5, 2
Refined wheat is less nutritious than whole wheat because:
Choose one answer.
a. refined wheat lacks nitrogen-fixing bacteria.
b. the bran and germ have been removed.
c. the cotyledons are removed prior to processing.
d. the plants have been grown in nutrient-poor soil.
the bran and germ have been removed.
Soybeans and other legumes are often used in crop rotation with grains because:
Choose one answer.
a. legumes can enhance soil fertility.
b. legumes increase soil phosphorus levels.
c. it will increase diversity.
d. grains and legumes can complement each other nutritionally.
legumes can enhance soil fertility
Starch is stored in the roots of plants in the:
Choose one answer.
a. phloem.
b. pith.
c. cortex.
d. endodermis.
c. cortex
The first event in the germination of a seed is:
Choose one answer.
a. imbibition of water.
b. enzyme production.
c. emergence of the root.
d. breakdown of stored starch.
. imbibition of water
The first structure to emerge from a seed during germination is/are the ______ for _________.
Choose one answer.
a. cotyledons / food acquisition
b. root / rapid water uptake
c. stem / rapid emergence from the soil
d. leaves / rapid photosynthesis
root / rapid water uptake
The Global Seed Vault:
Choose one answer.
a. is a repository for the seeds of all the plants in the world.
b. is located in Germany to be centrally located to the global population.
c. replaces seed banks in the rest of the world.
d. will stay below freezing even if all power is cut off, since it is located in an area of permafrost.
will stay below freezing even if all power is cut off, since it is located in an area of permafrost. Correct
The Global Seed Vault:
Choose one answer.
a. stores only the genomes of wheat, corn and rice.
b. stores seeds against a global catastrophe.
c. stores only grass seeds.
d. is located in Canada for the use of Canada and the U.S.
stores seeds against a global catastrophe
The major difference between monocot and eudicot seeds is that in monocot seeds, most of the nutritional reserves for germination are stored in the ____________, whereas in eudicot seeds, they are stored in the _______________.
Choose one answer.
a. endosperm / cotyledons
b. endosperm / stem
c. endosperm / root
d. coleoptile / cotyledons
e. seed coat / cotyledons
. endosperm / cotyledons
The nutrients that accumulate in the endosperm of a peanut soon after fertilization are later found in which of the following?
Choose one answer.
a. seed coat
b. fruit
c. cotyledons
d. seed
c. cotyledons
The problem with growing plants away from their centers of origin are:
Choose one answer.
a. they may be susceptible to new diseases.
b. they are unable to reproduce.
c. the people who live in these centers of origin have less food.
d. the farmers are less familiar with the crops.
they may be susceptible to new diseases.
The reason why a grain is not truly a seed is because:
Choose one answer.
a. it germinates underground.
b. there is no food supply for the developing embryo
c. there are numerous seeds per fruit.
d. the fruit wall is fused to the seed coat.
. the fruit wall is fused to the seed coat.
The starch used to thicken sauces and as a baby powder is produced by grinding the white, starchy material stored in corn seeds. This is actually material that was stored in the seed by the parent plant for the germination of these monocot seeds. In what part of a corn seed is this material located?
Choose one answer.
a. endosperm
b. cotyledon
c. seed coat
d. embryo
a. endosperm
The top maize-producing country is:
Choose one answer.
a. Mexico.
b. China.
c. Brazil.
d. USA.
USA.
The top wheat producing country is:
Choose one answer.
a. Russia
b. China
c. USA
d. Australia
b. China
The top white potato producing country is:
Choose one answer.
a. USA
b. China
c. Ireland
d. Peru
b. China
The tuberous root of which plant is a common food item?
Choose one answer.
a. maize
b. white potato
c. soybean
d. cassava
d. cassava
The two halves of a peanut seed that come apart when you split the seed open are actually:
Choose one answer.
a. cotyledons.
b. the fruit.
c. seed coats.
d. endosperm.
a. cotyledons.
Through domestication and artificial selection,:
Choose one answer.
a. crop plants may lose the ability to compete with wild relatives.
b. crop plants often have a reduced range.
c. the genetic diversity of crop plant populations is increased.
d. crop plants no longer rely on sexual reproduction for seed production.
a. crop plants may lose the ability to compete with wild relatives.
We grind wheat seeds and use the white, starchy material to make bread and pasta. This material is actually produced by the seed to:
Choose one answer.
a. protect the seed from being eaten.
b. develop into the young plant.
c. nourish the developing embryo.
d. nourish the developing fruit.
c. nourish the developing embryo.
What are the first two substances adsorbed for seed germination and what function does each play?
Choose one answer.
a. water for respiration / CO2 for photosynthesis
b. water for enzymatic reaction / O2 for respiration
c. water and light / both for photosynthesis
d. water for translocation / CO2 for respiration
b. water for enzymatic reaction / O2 for respiration
Wheat originated in what is now:
Choose one answer.
a. Mexico.
b. India.
c. Iran.
d. France.
c. Iran
When bean seeds (eudicot) germinate, enzymes are produced that start to digest the food materials stored in the:
Choose one answer.
a. seed coat.
b. fruit.
c. endosperm.
d. cotyledons.
d. cotyledons.
When we eat blue corn chips, we are really eating the:
Choose one answer.
a. endosperm.
b. the embryo.
c. cotyledons.
d. fruit tissue.
a. endosperm
When you examine a potato carefully you can see potato eyes that form a tight spiral arrangement around a central eye on one end of the potato. The presence of these eyes indicates that this underground plant structure is actually a modified:
Choose one answer.
a. leaves.
b. stems.
c. fruits.
d. roots.
b. stems.
Where do plants store energy?
Choose one answer.
a. in fruits and seeds only
b. in seeds, modified stems, and storage roots
c. in modified stems and storage roots only
d. in the seeds only
b. in seeds, modified stems, and storage roots
Which three grasses together feed much of the world?
Choose one answer.
a. corn, soybeans, bananas
b. potatoes, barley, wheat
c. rice, wheat, corn
d. coffee, sugar, grapes
c. rice, wheat, corn
Which country ranks second in rice production?
Choose one answer.
a. China
b. India
c. Indonesia
d. USA
b. India
Which crop yields the most protein per acre in unfertilized soil?
Choose one answer.
a. corn
b. potato
c. soybeans
d. cassava
c. soybeans
Which is a pulse?
Choose one answer.
a. rice
b. cassava
c. corn
d. soybean
c. soybean
Which is NOT an example of artificial selection?
Choose one answer.
a. the breeding of selected organisms by humans
b. domesticated plants
c. environmental pressures causing certain plants to become more abundant
d. the development of cabbage, brussels sprouts and broccoli from a wild progenitor
e. the domestication of corn from the grass teosinte
c. environmental pressures causing certain plants to become more abundan
Which is the top cassava producing country?
Choose one answer.
a. China
b. Peru
c. USA
d. Nigeria
d. Nigeria
Which is the top peanut producing country?
Choose one answer.
a. USA
b. China
c. Kenya
d. Nigeria
b. China
Which is the top sorghum producing country?
Choose one answer.
a. Germany
b. USA
c. Brazil
d. China
b. USA
Which is the top sweet potato producing country?
Choose one answer.
a. Nigeria
b. USA
c. China
d. Brazil
c. China
Which of the following are the four crops that provide the most calories for the peoples of the world?
Choose one answer.
a. corn, rice, cassava, and wheat
b. soybeans, corn, rice and wheat
c. wheat, rice, corn and white potato
d. white potato, rice, millet and chickpeas
c. wheat, rice, corn and white potato
Which of the following crop plants can grow on marginal land with frequent droughts?
Choose one answer.
a. millet
b. cassava
c. maize
d. rice
a. millet
Which of the following crop plants grows best in a cool, moist environment?
Choose one answer.
a. millet
b. maize
c. cassava
d. rice
c. cassava
Which of the following processes happens during seed germination?
Choose one answer.
a. The materials released from the endosperm are transported to the soil.
b. The food reserves stored in the endosperm are broken down by newly-made enzymes.
c. The embryo uses the endosperm materials immediately for photosynthesis.
d. The endosperm gains nutrients from bacteria in the seed coat.
The food reserves stored in the endosperm are broken down by newly-made enzymes.
Which of these crops originated in Central America?
Choose one answer.
a. sorghum
b. corn
c. soybean
d. wheat
b. corn
Which one of the following crops is cultivated almost exclusively in the same region as its center of origin?
Choose one answer.
a. yams
b. soybean
c. potato
d. rice
a. yams
Which part of the plant has the largest amount of stored protein and carbohydrate relative to its size?
Choose one answer.
a. root
b. stem
c. leaf
d. seed
d. seed
Which two parts serve the same function during the germination of a seed?
1. cotyledon
2. radicle
3. seed coat
4. endosperm
Choose one answer.
a. 3 and 2
b. 1 and 4
c. 1 and 3
d. 2 and 4
b. 1 and 4
Why are animal proteins considered higher quality proteins than plant proteins?
Choose one answer.
a. The number of grams of amino acids per serving is greater.
b. They represent a higher trophic level.
c. The number of grams of protein per serving is greater.
d. The ratio of essential amino acids more closely matches our body
The ratio of essential amino acids more closely matches our body
Why are refined grains often fortified?
Choose one answer.
a. to add back taste and texture
b. to add back carbohydrates
c. to add back vitamins and minerals
d. to add back fats
C
A flower that lacked which of the following would still be capable of sexual reproduction?
a. carpels
b. petals
c. stamens
d. ovules
petals
A plant that is described as dioecious has _________ flowers.
Choose one answer.
a. perfect
b. monoecious
c. imperfect
d. self-compatible
c. imperfect
After hearing that you have taken Integrative Biology 102 at the U of I, a neighbor asks your advice concerning his fruit tree. It seems his tree produces flowers but no fruit. He has even tried to pollinate the flowers by hand, but to no avail. Your observations reveal that the flowers are perfect. There are no other trees of the same species in the neighbor
Choose one answer.
a. dioecious.
b. monoecious.
c. self-incompatible.
d. self-compatible.
self-incompatiblec
All sporophytes all have one characteristic in common. They:

Choose one answer.
a. have only one set of genetic information.
b. require water for sperm transfer to the egg.
c. produce spore mother cells that divide by meiosis.
d. are haploid.
e. are dependent on the gametophyte stage.
. produce spore mother cells that divide by meiosis.
as a plant breeder you wish to cross pollinate two individuals of a plant species that is dioecious. What must you do to the seed producing plant to prevent self pollination and self fertilization?
Choose one answer.
a. Remove all the male flowers.
b. Remove the ovaries.
c. Nothing.
d. Remove the stamens.
. Nothing
At what stage during meiosis do homologous chromosomes come together side-by-side and participate in "crossing-over"?
Choose one answer.
a. Prophase I
b. Prophase II
c. Anaphase I
d. Telophase I
e. Metaphase I
a. Prophase I
Banana plants are propagated from rhizomes and, therefore, all plants in a plantation may share a common ancestor. Which statement about such a plantation of bananas is FALSE?

Choose one answer.
a. The fruit tends to be uniform in quality.
b. The offspring result from fertilization of egg cells.
c. There is little genetic variation in the plantation.
d. An introduced plant disease could easily affect the entire crop.
e. There is uniformity in growth pattern and yield throughout the plantation.
b. The offspring result from fertilization of egg cells
Both meiosis and fertilization:
Choose one answer.
a. result in decreased genetic variation.
b. contribute to genetic variation in populations.
c. are initiated in the gametophyte stage.
d. are processes in which crossing over occurs.
e. decrease the chromosome number by one-half.
b b. contribute to genetic variation in populations.
Crossing-over is a genetic process in which:
Choose one answer.
a. a chromosome moves over form one side of a nucleus to the other.
b. the two chromatids of a chromosome exchange sequences.
c. two homologous chromosomes exchange sequences.
d. sperm chromosomes pass over into the egg.
c. two homologous chromosomes exchange sequences
Genetic variability is increased by all of the following processes EXCEPT:
Choose one answer.
a. meiosis.
b. mitosis.
c. fertilization.
d. independent assortment.
e. crossing-over.
. mitosis.
In order to successfully pass its genes onto the next generation, the male gametophyte of a flowering plant, must first:
Choose one answer.
a. land on the stigma.
b. land on the flower petal.
c. land directly on the ovary.
d. land directly on the female gametophyte.
a. land on the stigma.
In plants, meiosis directly produces:
Choose one answer.
a. zygote.
b. spore cells.
c. gametes.
d. sporophyte.
b. spore cells
Marks: 1
In the alternation of generations of higher plants, which of the following processes is most responsible for the passage from the sporophyte to the gametophyte generation?
Choose one answer.
a. embryogenesis
b. pollination
c. mitosis
d. meiosis
e. fertilization
d. meiosis
In which organ(s) do(es) meiosis occur?
1. anther
2. filament
3. stigma
4. ovule
Choose one answer.
a. 2 & 4
b. 1 only
c. 3 only
d. 1 & 4
d. 1 & 4
In which situation is sexual reproduction favored over asexual reproduction?
Choose one answer.
a. Bamboo spreading down a river bank
b. A maple population trying to cope with a newly introduced disease
c. A red bud tree living in a stable, unchanging forest
d. A violet population competing for space in a meadow
b. A maple population trying to cope with a newly introduced disease
Meiosis of a spore mother cell results in the production of:
Choose one answer.
a. 4 haploid cells.
b. 4 diploid cells.
c. 2 haploid cells.
d. 2 diploid cells.
. 4 haploid cells.
Meiosis produces:
Choose one answer.
a. 2 diploid cells with different genetic combinations.
b. 4 haploid cells with different genetic combinations.
c. 4 diploid cells with different genetic make up.
d. 2 diploid cells with identical genetic information.
b. 4 haploid cells with different genetic combinations.
Meiosis results in:
Choose one answer.
a. daughter cells identical to one another.
b. doubling of the genetic material of the parent.
c. new genetic combinations.
d. formation of the sporophyte generation.
c. new genetic combinations.
Meiosis:
Choose one answer.
a. restricts independent assortment of chromosomes.
b. occurs only in the anthers of flowers.
c. occurs in the gametophyte.
d. reduces the number of chromosomes by one half.
d. reduces the number of chromosomes by one half
Pea plants routinely self pollinate even before the flowers are completely open. What would you need to do to cross pollinate two different varieties of pea plants and avoid self-pollination? Remove the______________ from the flowers that are to produce seeds.

Choose one answer.
a. stamens
b. ovaries
c. stigmas
d. ovules
a. stamens
Prior to pollination, what part of a perfect flower is made of haploid cells?
Choose one answer.
a. the ovary and the receptacle
b. the anther and the stigma
c. the embryo sac and pollen
d. the stamen and the style
c. the embryo sac and pollen
Marks: 1
Strawberries reproduce asexually by runners. Which event is NOT necessary for asexual reproduction in strawberries?
Choose one answer.
a. duplication of genetic information
b. reduction of chromosome number
c. differentiation of cells
d. mitosis
e. stem elongation
b. reduction of chromosome number
The basic source of new genes in a population is mutation. The amount of variation is further increased by:

Choose one answer.
a. asexual reproduction.
b. environmental stability.
c. cloning.
d. crossing over.
d. crossing over
The cell(s) that result from meiosis of a spore mother cell is/are:
Choose one answer.
a. one haploid cell.
b. four haploid cells.
c. one diploid cell.
d. four diploid cells.
b. four haploid cells.
The cost of sex in plants is offset by:
Choose one answer.
a. large amounts of pollen being produced.
b. large amounts of ovules being produced.
c. showy flowers that attract pollinators.
d. increased genetic variation in the offspring.
d. increased genetic variation in the offspring
The function of petals in a showy flower like an orchid is to:
Choose one answer.
a. protect the young seeds.
b. nourish the developing embryo.
c. attract animals to the stigma and stamens.
d. defend the plant from herbivores.
c. attract animals to the stigma and stamens
The male gametophyte of a flowering plant is ano:
Choose one answer.
a. seed.
b. pollen grain.
c. ovule.
d. spore mother cell.
b. pollen grain
Through the processes of __________ and ___________, new combinations of genes are possible.
Choose one answer.
a. independent assortment / crossing over
b. seed dispersal / cell division
c. meiosis / pollination
d. vegetative reproduction / cell division
a. independent assortment / crossing over
Two processes that are exclusively involved in sexual reproduction are:
Choose one answer.
a. mitosis and selection.
b. selection and evolution.
c. meiosis and fertilization.
d. mitosis and pollination.
e. mitosis and meiosis.
c. meiosis and fertilization.
What do potato tubers, iris bulbs and strawberry runners have in common?
Choose one answer.
a. They are all means of sexual propagation.
b. They are all classified as petioles.
c. They are all modified stems.
d. They are all modified roots.
e. They are all food storage organs.
c. They are all modified stems.
What is an advantage that sexual reproduction has over asexual reproduction?
Choose one answer.
a. Sexual reproduction produces more genetic variation in the offspring.
b. Sexual reproduction is not affected by mutations.
c. Sexual reproduction assures that offspring are genetically identical.
d. Offspring are produced more rapidly through sexual reproduction.
e. Plants of all ages can reproduce by sexual reproduction.
a. Sexual reproduction produces more genetic variation in the offspring
Which best describes the process of meiosis?
Choose one answer.
a. Meiosis is involved in vegetative reproduction of plants from leaves and stems.
b. Meiosis produces new genetic combinations.
c. Meiosis results in the production of a genetically uniform population.
d. Most cell divisions in plants occur by this process.
e. Meiosis produces cells that are genetically identical.
b. Meiosis produces new genetic combinations
Which breeding system would give a population the lowest amount of genetic variation in the offspring?
Choose one answer.
a. self-incompatibility, perfect flowers
b. self-incompatibility, monoecious plants
c. self-compatibility, perfect flowers
d. self-compatibility, monoecious plants
c. self-compatibility, perfect flower
Which explains why chromosomes come in homologous pairs?
Choose one answer.
a. Plant cells can only exist in the diploid state.
b. They have been duplicated.
c. They are joined at the centromere.
d. The pairs are a result of fertilization.
d. The pairs are a result of fertilization.
Which flower part has as its primary function the protection of the developing flower bud?
Choose one answer.
a. receptacle
b. petals
c. sepals
d. anther
c. sepals
Which is an example of root tissue modified for asexual reproduction?
Choose one answer.
a. suckers of Aspen tree
b. stolon of strawberries
c. tuber of potato
d. rhizome of iris
e. corm of crocus
a. suckers of Aspen tree
Which is one advantage of asexual reproduction?
Choose one answer.
a. Times reproduction for greatest dispersal.
b. Results in variable offspring that might suit a new habitat.
c. During meiosis, genetic variation is increased.
d. Does not require care for offspring.
e. Allows an organism to quickly fill a habitat.
e. Allows an organism to quickly fill a habitat.
Which is the most important contribution of meiosis to evolution?
Choose one answer.
a. Meiosis results in the production of a genetically uniform population.
b. Meiosis is involved in vegetative reproduction of plants from leaves and stems.
c. Meiosis produces new genetic combinations.
d. Most cell divisions in plants occur by this process.
e. All the products of meiosis are genetically identical.
c. Meiosis produces new genetic combinations.
Which of the following is a correct comparison between vegetative and sexual reproduction?
Choose one answer.
a. In a changing environment, sexually reproduced individuals are less likely to survive than those propagated vegetatively.
b. Sexual reproduction involves meiosis; vegetative propagation involves mitosis and meiosis.
c. It is usually less costly to produce plants sexually than through vegetative propagation.
d. Individuals produced through vegetative propagation are more like their parent than those produced through sexual reproduction.
e. If an unusual trait is found in nature, it is more likely the result of vegetative propagation than sexual reproduction.
d. Individuals produced through vegetative propagation are more like their parent than those produced through sexual reproduction
Which of the following is NOT a modified stem?
Choose one answer.
a. strawberry runners
b. carrots
c. the base of an onion bulb
d. potato tubers
e. iris rhizomes
. carrots
Which of the following is one advantage of asexual reproduction?
Choose one answer.
a. It reduces competition between parents and offspring.
b. It results in variable offspring to fill a new habitat.
c. It allows an organism to quickly fill a new habitat.
d. It times reproduction for maximum seed dispersal.
e. It requires the evolution of a commensal symbiosis.
It allows an organism to quickly fill a new habitat
Which of the following is true about meiosis?
Choose one answer.
a. Chromosomes frequently exchange genetic material during the process.
b. The process always yields cells that are genetically identical the parent cell.
c. The process yields two cells.
d. The process only takes place in meristems.
e. Daughter cells are produced that have exactly the same number of chromosomes as parent cells.
a. Chromosomes frequently exchange genetic material during the process
Which of the following transitions includes meiosis?
Choose one answer.
a. sporophyte to spore mother cells
b. spore to gametophyte
c. gametophyte to egg
d. spore mother cells to spore
. spore mother cells to spore
Which of the following transitions involves the process of meiosis?
Choose one answer.
a. sporophyte to spore mother cells
b. egg to zygote
c. sporophyte to spore
d. spore to gametophyte
e. gametophyte to egg
c. sporophyte to spore
Which orders correctly reflect a sequence of stages in the basic sexual life cycle of a plant?
1. meiosis, sporophyte, spore, zygote
2. sporophyte, spore mother cell, meiosis, spore
3. gametophyte, meiosis, zygote, sporophyte
4. zygote, fertilization, sporophyte, spore
5. spores, gametophyte, gametes, fertilization
6. fertilization, gametes, mitosis, gametophyte
Choose one answer.
a. 5 & 2
b. 1 & 5
c. 6 & 1
d. 2 & 6
e. 3 & 4
5 & 2
Which statement is FALSE? Natural vegetative (asexual) reproduction:
Choose one answer.
a. results from fertilization of an egg cell.
b. produces offspring genetically identical to the parent.
c. utilizes less energy while producing offspring than sexual reproduction.
d. can be quicker than sexual reproduction in establishing a plant colony.
e. may result from natural rooting along runners.
a. results from fertilization of an egg cell
Which undergo meiosis?
Choose one answer.
a. egg cells
b. gametophyte
c. spore mother cells
d. spores
e. sperm cells
c. spore mother cells Correct
A beehive with colony collapse disorder is characterized by:
Choose one answer.
a. no remaining bees or honey
b. only worker bees and honey remain
c. only the queen, immature bees and honey remain
d. no worker bees or queen remain
only the queen, immature bees and honey remain
A contributing factor to colony collapse disorder and the loss of honeybees is:
Choose one answer.
a. introduction of bees from Argentina.
b. viral infection.
c. competition with native bees.
d. bacterial infection.
b. viral infection
A flower with a dark color, a landing platform and a smell like rotting meat is most likely pollinated by which of the following?
Choose one answer.
a. bees
b. butterflies
c. flies
d. moths
c. flies
A mature pollen grain represents which point in the life cycle of an angiosperm plant?
Choose one answer.
a. gametophyte
b. spore
c. mature sporophyte
d. gamete
a. gametophyte
A monoecious plant species would have _____________ located on ___________.
Choose one answer.
a. perfect flowers / the same plant
b. incomplete flowers / separate plants
c. either male or female flowers / separate plants
d. both male and female flowers / the same plant
d. both male and female flowers / the same plant Correct
A perfect flower possesses which of the following?
Choose one answer.
a. either stamens or carpels
b. both stigma and ovary
c. both stamens and carpels
d. both petals and sepals
both stamens and carpels
A plant species that is dioecious includes plants that:
Choose one answer.
a. have both staminate and carpellate flowers on the same plant.
b. are self-compatible.
c. have perfect flowers.
d. have either carpellate or staminate flowers, not both.
have either carpellate or staminate flowers, not both.
Marks: 1
A plant that is self-incompatible must be pollinated by pollen from:
Choose one answer.
a. a plant in another plant family.
b. the stamens of the same flower.
c. another plant of the same species.
d. a plant of another species.
another plant of the same species
A plant with a white flower that emits a strong scent after dark is likely pollinated by a:
Choose one answer.
a. hummingbird.
b. moth.
c. fly.
d. bee.
moth
A plant with large white to pink flowers that emit a strong sweet scent after dark and with lots of nectar is likely pollinated by a:
Choose one answer.
a. butterfly.
b. bat.
c. hummingbird.
d. moth.
moth
A plant with nectar guides, a landing platform, open during the day and a sweet scent is likely pollinated by:
Choose one answer.
a. bats.
b. bees.
c. hummingbirds.
d. moths.
. bees.
A plant with red long tubular flowers that produces copious nectar is likely to be pollinated by:
Choose one answer.
a. bats.
b. hummingbirds.
c. moths.
d. bees.
b. hummingbirds.
A possible evolutionary advantage of cross pollination between plants of the same species is that it:
Choose one answer.
a. decreases mutations.
b. controls fluctuations in the environment.
c. assures hybridization with other species.
d. increases the chance of new gene combinations.
increases the chance of new gene combinations.
A researcher studying seed development in a plant put bags over all the flowers to ensure pollination. Yet none of the flowers set seed. Which is NOT a possible explanation?

Choose one answer.
a. The plant was dioecious.
b. The flowers were perfect and self-compatible.
c. A specific animal pollinator was required.
d. Wind pollination was required.
The flowers were perfect and self-compatible.
As summer approaches, your neighbor asks you to give him some advice on which plants to add to his garden in order to attract some hummingbirds. He has five varieties but cannot remember their names and so describes them. Which would be best based on your knowledge of pollination?

Choose one answer.
a. a tubular, bright red flower that has no discernible scent
b. a small blue flower that opens early each morning and has a strong scent
c. a yellow flower with UV nectar guides
d. a very stinky brown flower like Devil's tongue
. a tubular, bright red flower that has no discernible scent
Corn plants have tassels that produce the pollen and ears that produce the grain. Corn has _____________ flowers and are ______________ plants.

Choose one answer.
a. imperfect / dioecious
b. imperfect / monoecious
c. incomplete / dioecious
d. perfect / self-incompatible
b. imperfect / monoecious
Dioecious plants have a selective advantage in that:
Choose one answer.
a. they never have to rely on animals to move their pollen.
b. pollen is produced on the same plant as the egg.
c. separate male and female plants increase genetic variation.
d. it takes less energy to make one flower type than two.
separate male and female plants increase genetic variation.
Dioecious plants have:
Choose one answer.
a. perfect flowers.
b. male and female flowers on the same plant.
c. imperfect flowers.
d. flowers with both anthers and ovaries.
c. imperfect flowers
Ferrari-red, tubular stiff flowers with exposed stamens, no odor, and lots of dilute nectar growing in the New World are likely pollinated by what?
Choose one answer.
a. moths
b. butterflies
c. hummingbirds
d. honey bees
c. hummingbirds
Grasses are wind pollinated, which is a hit-a-few, miss-a-lot affair. What accounts for their success?
Choose one answer.
a. large pollen grains
b. sticky pollen grains
c. large amounts of pollen grains
d. tasty pollen grains
large amounts of pollen grains
If a plant's flowers have practically no petals, no fragrance and no nectar, but produce huge amounts of pollen, it is a good bet that the flowers are pollinated by:
Choose one answer.
a. insects
b. bats.
c. a person.
d. birds.
e. wind.
e. wind.
If we were to use botanical terminology to describe the arrangement of sexual functions in humans, we might say that we are:
Choose one answer.
a. perfect and monoecious.
b. perfect and dioecious.
c. imperfect and monoecious.
d. imperfect and dioecious.
imperfect and dioecious.
in a single flower, pollen grains from an anther fall on the stigma of the same flower, but pollen tube fails to grow properly resulting in no fertilization. What term best describes this phenomenon?
Choose one answer.
a. self-compatible
b. self-incompatible
c. monoecious
d. dioecious
. self-incompatible
In order to successfully pass its genes onto the next generation, the male gametophyte of a flowering plant, must first:
Choose one answer.
a. land on the stigma.
b. perform a mating ritual.
c. land directly on the female gametophyte.
d. land directly on the ovary.
. land on the stigma.
In wind-pollinated flowers such as wheat, the __________ are likely to be absent.
Choose one answer.
a. petals
b. stigmas
c. stamens
d. ovaries
a. petals
Is Colony Collapse Disorder only a problem in the U.S.?
Choose one answer.
a. Yes, no other countries raise honeybees.
b. No, it is also a problem in S. Am. and Canada.
c. No, it is a global problem.
d. Yes, but only in the Northeast.
. No, it is a global problem.c
Perfect flowers can NEVER:
Choose one answer.
a. be self-compatible.
b. have both a pistil and stamen.
c. be dioecious.
d. be self-incompatible.
c. be dioecious
Plants that are monoecious have flowers that are:
Choose one answer.
a. perfect and sexes occur on same plant.
b. perfect and sexes occur on different plants.
c. imperfect and sexes occur on different plants.
d. imperfect and sexes occur on same plant.
d. imperfect and sexes occur on same plant
Small, green, odorless and nectarless incomplete flowers with anthers on long filaments and stigmas large and feathery are likely pollinated by what?
Choose one answer.
a. Insects
b. Wind
c. Water
d. Birds
wind
The gametophyte phase in flowering plants is represented by the:
Choose one answer.
a. pollen grain and mature ovule (embryo sac).
b. flower.
c. sperm and egg nuclei only.
d. egg cell only.
pollen grain and mature ovule (embryo sac)
The simplest male flower using wind as the pollination agent might consist only of:
Choose one answer.
a. a ring of sepals extending from a cup of green petals.
b. an exposed stigma supported by a long style.
c. a bare receptacle with a single stamen.
d. a carpel containing a single ovule.
a bare receptacle with a single stamen
To facilitate animal pollination, flowers must offer a reward. Which one of the following is NOT a typical reward offered by a flower?
Choose one answer.
a. pollen
b. nectar
c. nectar guide
d. sex
c. nectar guide
Transfer of the male gametes from one tree's flower to the stigma of a flower on a distant tree of the same species achieves:
Choose one answer.
a. cross-pollination.
b. fertilization.
c. self-pollination.
d. incomplete pollination.
. cross-pollination.
What information can scientists learn from soil cores taken from lake bottoms about climate?
Choose one answer.
a. The type of pollen in the soil indicates whether crop plants were growing near the lake, and therefore, if the area
b. The type of soil will indicate the type of plants that have lived around the lake.
c. Pollen in the soil cores can predict the future climate.
d. The type of pollen in the soil indicates the plants and, therefore, the climate of the past.
The type of pollen in the soil indicates the plants and, therefore, the climate of the past
What of the following describes colony collapse disorder?
Choose one answer.
a. The disappearance of the queen and worker honey bees from the hive while the immature bees remain.
b. The inability of worker honey bees to gather enough pollen and nectar for the immature bees in the hive.
c. The slow deterioration of a hive upon the death of the queen.
d. The disappearance of worker honey bees from a hive while the queen, immature bees, and food reserves remain.
The disappearance of worker honey bees from a hive while the queen, immature bees, and food reserves remain. Correct
What pair of crops are dependent upon honeybees for pollination?
Choose one answer.
a. almonds and corn
b. almonds and wheat
c. apples and wheat
d. almonds and apples
. almonds and apples
What would happen if all the honeybees disappeared?
Choose one answer.
a. Native bees can be used as alternative pollinators.
b. The majority of the world's population would suffer from malnutrition.
c. Cereal grasses, such as wheat and corn, could not be pollinated.
d. Plants with yellow or blue flowers, nectar guides and sweet odor would cease to exist.
Native bees can be used as alternative pollinators
Which is an example of a monoecious plant?
Choose one answer.
a. A geranium plant with perfect flowers but whose anthers mature before the stigma is receptive.
b. A honeysuckle whose perfect flowers have different arrangements of stamens and styles.
c. A begonia plant with separate male and female flowers on the same plant.
d. A willow tree having separate male and female individuals.
A begonia plant with separate male and female flowers on the same plant
Which of the following does NOT explain why honeybees are effective pollinators?
Choose one answer.
a. They are deliberately gathering pollen to feed to their young.
b. They live in colonies so they can be mass-utilized to pollinate a field of crops quickly.
c. They have specialized pollen-carrying structures called pollen baskets.
d. They out-compete the native bees and other insect pollinators for pollen and nectar.
They out-compete the native bees and other insect pollinators for pollen and nectar.
Which of the following about flowers is correct?
Choose one answer.
a. A complete flower is probably always wind pollinated.
b. A perfect flower may also be incomplete.
c. A perfect flower may be missing either its carpels or its stamens.
d. An imperfect flower may also be complete.
. A perfect flower may also be incomplete.
Which of the following is neither an attractant nor a reward used in pollination systems?
Choose one answer.
a. water
b. nectar
c. female sex scents
d. pollen
a. water
Which pair correctly illustrates a co-evolved pollination mechanism?
Choose one answer.
a. rotten scent and bird olfactory organs
b. dark-purple petals and moth vision
c. white petals and nocturnal bats
d. red petals and pollen buckets on bees
white petals and nocturnal bats
Which pair correctly illustrates a co-evolved pollination mechanism?
Choose one answer.
a. red petals and color vision in birds
b. large amounts of pollen and forceful wind
c. rotten scent and butterflies
d. strong scents and bird beaks
red petals and color vision in birds
Which pair correctly illustrates a co-evolved pollination mechanism?
Choose one answer.
a. red petals and pollen buckets on bees
b. large amounts of pollen and forceful wind
c. rotten scent and fly olfactory organs
d. strong scents and bird beaks
. rotten scent and fly olfactory organs
Your neighbor has heard that you are taking plant biology at the Big U. and asks you to check out his fruit tree in the spring. The problem is that the tree flowers every year, but never sets fruit. You look at the flowers and see that each flower has normal looking carpels and stamens and produces lots of pollen. After looking around the neighborhood you can find no other trees of the same species. You should conclude that the tree species:
Choose one answer.
a. has imperfect flowers, but is self incompatible.
b. has perfect flowers, but is self incompatible.
c. is monoecious.
d. is dioecious.
has perfect flowers, but is self incompatible.
A burr is an example of what kind of seed dispersal?
Choose one answer.
a. animal dispersal by droppings
b. wind dispersed by wings
c. animal dispersal by hooks
d. animal dispersal by rain drops
. animal dispersal by hooks
A certain cell from an angiosperm possesses 15 chromosomes, yet it is known that the 2N number for this species is 10. From what structure was this cell most likely isolated?
Choose one answer.
a. stem
b. pollen
c. endosperm
d. embryo
c. endosperm
A fruit is primarily:
Choose one answer.
a. an organ for dispersal.
b. an organ for photosynthesis.
c. a seed.
d. a seed coat.
. an organ for dispersal
Marks: 1
A peanut (including the shell or hull) is actually a ________ that develops underground.
Choose one answer.
a. stem
b. fruit
c. leaf
d. root
b. fruit
A plant whose seeds are encased in a prickly covering are likely to be dispersed by:
Choose one answer.
a. fast moving water
b. animals with fur
c. birds
d. light wind
b. animals with fur
A raspberry is an example of what kind of seed dispersal?
Choose one answer.
a. wind dispersed by wings
b. animal dispersal by droppings
c. animal dispersal by rain drops
d. animal dispersal by burrs
b. animal dispersal by droppings
Complex fruits develop from multiple _______ whereas simple fruits always develop from just one _________.
Choose one answer.
a. ovaries / ovary
b. ovules / ovule
c. flowers / flower
d. ovaries / ovule
flowers / flower
As a flower matures after pollination and fertilization the ______________ develop into the seeds and the ____________ develops into the fruit.
Choose one answer.
a. ovules / ovary
b. ovary / eggs
c. receptacles / sepals
d. pollen / stigma
ovules / ovary
Diverse structures and strategies have evolved to promote seed dispersal. This is because seed dispersal:
Choose one answer.
a. allows for efficient use of the energy stored in the seed.
b. insures fertilization.
c. allows offspring to avoid competition with their successful parent.
d. decreases dependency on animals.
c. allows offspring to avoid competition with their successful parent.
Following fertilization in a flowering plant, the fruit usually develops from the expanded of the flower.
Choose one answer.
a. stamen
b. anther
c. ovary
d. ovule
c. ovary
For plants, dispersal through time:
Choose one answer.
a. requires a symbiotic relationship with a fungus.
b. has a payoff if the environment changes.
c. is futile. Plants cannot travel through time.
d. is an uncommon strategy without much benefit.
b. has a payoff if the environment changes.
Grapes are sprayed with a gibberellic acid solution in order to:
Choose one answer.
a. prevent them from making seeds.
b. make their stems elongate more to accommodate bigger grapes.
c. prevent their seeds from germinating while still in the grape.
d. convert starch to sugar in seeds.
make their stems elongate more to accommodate bigger grapes
in a strict botanical sense, which one of the following plants can be considered a fruit?
Choose one answer.
a. pulse
b. chickpea
c. tomato
d. yam
c. tomato
In flowering plants, the two polar nuclei of the ovule fuse with a sperm nucleus of the pollen to produce:
Choose one answer.
a. a fertile zygote.
b. a megaspore mother cell.
c. diploid ovules.
d. triploid endosperm.
d. triploid endosperm
It is said that one can get a banana to ripen quickly by wrapping it in paper or putting it in a bag with a ripe apple. How would you evaluate this statement?

Choose one answer.
a. Folklore with no basis in fact.
b. True because ethylene produced by the apple would ripen the banana.
c. Entirely untrue because fruits must ripen while attached to the parent plant.
d. Untrue because ripening in one fruit is totally unaffected by development of another fruit.
b. True because ethylene produced by the apple would ripen the banana.
Many fruits, like bananas, are picked "green" (unripened) to be shipped long distances. At their destination they can be treated with a plant hormone to speed the ripening process. Which hormone would be the best choice?
Choose one answer.
a. ethylene
b. gibberellin (GA)
c. cytokinin
d. abscisic acid (ABA)
a. ethylene
Putting a ripe banana in a bag with unripe tomatoes will:
Choose one answer.
a. accelerate ripening in the tomatoes, as a result of ethylene released from the banana.
b. result in the tomatoes turning brown, since that's what ripening bananas do.
c. inhibit ripening of the tomatoes, since the banana will be using up all the ethylene for its ripening.
d. do nothing, because bananas and tomatoes are not closely enough related to ripen by the same mechanism.
a. accelerate ripening in the tomatoes, as a result of ethylene released from the banana
Ripe fruits may provide an advantage to a plant because they:
Choose one answer.
a. prevent seed dormancy.
b. prevent seed abortion.
c. allow for more effective seed dispersal.
d. can be used as a stored source of food by the seedling.
allow for more effective seed dispersal
Seed dispersal is enhanced by maturation of which structure?
Choose one answer.
a. ovary
b. filament
c. ovule
d. style
a. ovary
Suppose you slice a tomato and find that it contains 78 seeds. What is the minimum number of ovules that were produced in the tomato?
Choose one answer.
a. 39
b. more than 78 or several hundred
c. 1
d. 78
d. 78
The fruit of a flowering plant develops from the:
Choose one answer.
a. embryo sac.
b. zygote.
c. ovary.
d. endosperm.
c. ovary
The next time you are handled a dish of green beans at the dinner table and asked if you care for some vegetables, you can explain that the bean pods are actually fruits that developed from the __________ of the bean flower, and the seeds inside them developed from the ___________.
Choose one answer.
a. anther / ovaries
b. ovary / ovules
c. ovaries / embryo sac
d. ovary / stigmas
b. ovary / ovules
The number of ovules in one ovary of a flowering plant:
Choose one answer.
a. rarely exceeds one.
b. is usually four.
c. is initially one, increases to four, then drops back to one.
d. may vary from one to hundreds.
d. may vary from one to hundreds.
The primary purpose of _____ is to promote seed dispersal.
Choose one answer.
a. female gametophyte
b. fertilization
c. fruit
d. pollen
c. fruit
The rind (outer skin) of a watermelon developed from which flower structure?
Choose one answer.
a. ovule
b. egg
c. ovary
d. gametophyte
c. ovary
The ripening of fruits may provide an advantage to a plant because a ripe fruit:
Choose one answer.
a. allows for more effective seed dispersal.
b. can be used as a stored source of food by the seedling.
c. will nourish the developing embryo.
d. attracts pollinators.
. allows for more effective seed dispersal
Two fertilization events occur in one ovule in flowering plants. One event results in the formation of the zygote. What develops from the second fertilization?
Choose one answer.
a. a layer of cells that encloses the seed
b. cells that become dispersal structures
c. a second embryo in ovule
d. cells that nourish the embryo
d. cells that nourish the embryo
Variation in the characteristics of flowers and fruits is primarily a result of natural selection by __________ and ___________ respectively.
Choose one answer.
a. pollinators / dispersers
b. seed dispersers / predators
c. pollinators / parasites
d. man / insects
a. pollinators / dispersers
When an apple fruit finally begins to ripen, it undergoes a series of changes, including the production of red pigment, conversion of starches and acids to sugar, and the breakdown of the pectins that make the unripe fruit hard. The activation of the genes that control these processes is triggered by:

Choose one answer.
a. ethylene.
b. gibberellic acid.
c. cold temperatures.
d. auxin.
a. ethylene.
Which does NOT occur during fruit ripening?
Choose one answer.
a. increase ethylene concentrations
b. increase in sugar produced
c. Increase in CO2 production.
d. development of light absorbing chemical compounds
d. development of light absorbing chemical compounds
Which hormone is responsible for fruit ripening?
Choose one answer.
a. auxin
b. cytokinin
c. ethylene
d. abscisic acid
c. ethylene
Which is an example of a complex fruit?
Choose one answer.
a. walnut
b. maple fruit
c. pea pod
d. raspberry
d. raspberry
Which is NOT a seed dispersal agent?
Choose one answer.
a. animals
b. nectar
c. wind
d. water
b. nectar
Diverse structures and strategies have evolved to promote seed dispersal. This is because seed dispersal:

Choose one answer.
a. allows for efficient use of the energy stored in the seed.
b. allows offspring to avoid competition with their successful parent.
c. insures fertilization.
d. decreases dependency on animals.
b. allows offspring to avoid competition with their successful parent.
Which of the following is a primary function of mature fruit?
Choose one answer.
a. disperse gametes
b. disperse seeds
c. attract pollinators
d. protect the mature sporophyte
. disperse seeds
Which of the following is NOT a mechanism for the dispersal of seeds?
Choose one answer.
a. coconut washing up on an island
b. a monkey disposing of a seed after eating the fruit
c. mice cross-pollinating flowers
d. seeds voided by elephants
c. mice cross-pollinating flowers
Which of the following is NOT a mechanism for the dispersal of seeds?
Choose one answer.
a. buoyancy of coconuts in water
b. pigs passing seeds from guava fruit
c. goldfinch moving pollen between plants
d. maple samaras floating on the wind
c. goldfinch moving pollen between plants
Which of the following is NOT a mechanism for the dispersal of seeds?
Choose one answer.
a. tumbleweed blowing in the wind
b. bats cross-pollinating flowers
c. migrating birds passing raspberries
d. sticky spines on fruit walls
. bats cross-pollinating flowers
Which of the following is true about the commercial application of plant hormones?
Choose one answer.
a. Ethylene sprayed on peach trees causes simultaneous flowering.
b. Ripening rooms release gibberellic acid to ripen pineapples before sale.
c. Gibberellic acid sprayed on grape vines results in longer stems and larger grapes.
d. Fruit is allowed to ripen on the vine, then sprayed with ethylene to slow rotting until displayed in a grocer.
c. Gibberellic acid sprayed on grape vines results in longer stems and larger grapes.
Which statement about fertilization in flowering plants is FALSE?
Choose one answer.
a. One sperm fertilizes the egg restoring the diploid number.
b. Fertilization is complete when the pollen is transferred from the anther to the stigma.
c. One fertilization results in the production of nutritive material.
d. Fertilization and meiosis increase variation through recombination.
e. Many fertilization events may take place within a single flower.
Fertilization is complete when the pollen is transferred from the anther to the stigma
Which statement about plant reproduction is TRUE?
Choose one answer.
a. The zygote is the protective layer formed around the developing seed.
b. The ovary develops into the fruit while the zygote develops into the embryo.
c. The ovary develops into the seed while the ovule develops into the embryo.
d. Two sperm cells and the egg cell fuse to form the endosperm.
. The ovary develops into the fruit while the zygote develops into the embryo.
Which statement about the development of a flowering plant is TRUE?
Choose one answer.
a. The ovary may become the attractant to animal dispersers.
b. The ovule becomes the nutrient source for the developing embryo.
c. Fertilization takes place only once in each flower.
d. The ovary stores food for the embryo.
The ovary may become the attractant to animal dispersers.
Which statement correctly describes double-fertilization in flowering plants?
Choose one answer.
a. One fertilization creates the zygote, the other the endosperm.
b. Two eggs are fertilized in the flower.
c. Two sperm fertilize the egg cell.
d. The egg and sperm fuse to form the zygote and the polar nuclei fuse to form the endosperm
One fertilization creates the zygote, the other the endosperm.
While carving your Halloween pumpkin you discovered that it contained 140 seeds. What is the minimum number of ovules that were produced in that pumpkin?
Choose one answer.
a. 70
b. It is impossible to tell from the information.
c. possible three hundred or more
d. 140
140
A re-evaluation of our methods to control insect pests is resulting in a development of pest control strategies that avoid ecological contamination. Which is an example of this kind of control?

Choose one answer.
a. planting monocultures
b. using non-biodegradable pesticides
c. reducing fertilizer applications
d. introducing predatory insects
d. introducing predatory insects
According to your readings and discussion concerning world agriculture and hunger, which statement is FALSE?
Choose one answer.
a. Improved plant varieties, fertilizer and irrigation contribute to increased food production in the world.
b. Politics and culture affect how successfully a new technology like the Green Revolution can be introduced into a country.
c. Agricultural technologies that work well and are productive in temperate areas always work well in tropical areas.
d. CGIAR is a global network of agriculture research centers.
Agricultural technologies that work well and are productive in temperate areas always work well in tropical areas
Allowing a field to lie fallow for a year:
Choose one answer.
a. restores some fertility to the soil.
b. leads to compacted soil.
c. is often a part of industrial agricultural practices.
d. allows crop pest populations to increase.
restores some fertility to the soil.
Although the "Green Revolution" has raised yields, some of the management practices encouraged the spread and/or severity of plant diseases. Which of the following management practices does NOT encourage the spread and/or severity of plant diseases?
Choose one answer.
a. Planting the same crop in the same field repeatedly.
b. Maintenance of genetic variety among crop plants.
c. Widespread asexual propagation of crop species.
d. Raising crops in monocultures.
. Maintenance of genetic variety among crop plants
Before hybrid crop plants were used extensively in agriculture, farmers had less of a problem with plant diseases reducing crop yield. This is because:
Choose one answer.
a. the varieties they used were a closer match to the regional environment.
b. they cultivated polyculture.
c. there were not as stringent controls on chemicals used to fight disease organisms.
d. more disease organisms have since been introduced into the U.S.
the varieties they used were a closer match to the regional environment.
Dr. Norman Borlaug developed high-yielding semi-dwarf varieties of wheat because:
Choose one answer.
a. they were less likely to fall over prior to harvesting.
b. they were naturally resistant to pests and pathogens.
c. they produced high yields in the absence of fertilizers and pesticides.
d. they grew well in the arid soils of Mexico.
. they were less likely to fall over prior to harvesting
Fields that have been cleared in tropical rainforests for the "Slash and Burn" system of agriculture are usually abandoned after only a few years of cultivation. Why is it necessary to abandon these fields and clear new ones?
Choose one answer.
a. decreased amount of sunlight
b. shorter growing seasons
c. increased competition for water
d. reduced mineral availability
d. reduced mineral availability
The long-term solution to the food crisis is for those countries currently requiring external food assistance to:
Choose one answer.
a. grow wheat, rice, corn and potatoes using the technologies of industrial agriculture.
b. develop higher-yielding, locally-adapted crops that require less energy and capital investment to grow.
c. grow grasses and nitrogen-fixing legumes together.
d. continually import food from developed countries.
e. increase irrigation and the use of fertilizers, pesticides and herbicides so that high yields of cereal grains can be obtained.
b. develop higher-yielding, locally-adapted crops that require less energy and capital investment to grow
In order for the "Green Revolution" to succeed among the poor farmers in developing countries, we would need to:

Choose one answer.
a. develop high yielding corn hybrids here in Illinois to send to the poor farmers.
b. provide the poor farmers with tractors and combines.
c. channel more food relief to these countries.
d. develop higher yielding local crops that require less energy and money to grow.
d. develop higher yielding local crops that require less energy and money to grow.
Industrial agriculture is based upon all of the factors listed below EXCEPT:
Choose one answer.
a. high fossil fuel use.
b. crop breeding programs.
a. evaporation of irrigated water draws salts to the surface of the soil poisoning the soil
d. extensive use of machinery.
c. small family farms
Irrigation of desert soils results in a greater yield followed by years of declining yields because:
Choose one answer.
a. evaporation of irrigated water draws salts to the surface of the soil poisoning the soil.
b. the water drains through the soil more quickly every year.
c. plants have not evolved to use that quantity of water available with irrigation.
d. water is lost through the stomates and not used by the plant.
a. evaporation of irrigated water draws salts to the surface of the soil poisoning the soil
One way conservation tillage (no- or low-) improves soil is by:
Choose one answer.
a. reducing the soil compaction around roots by reducing the passes over the field by equipment.
b. creating a lighter weight soil that blows away easily.
c. allowing the crop residue to build up necessitating more herbicide use.
d. decreasing the amount of irrigation necessary, and thereby increasing soil salinization.
reducing the soil compaction around roots by reducing the passes over the field by equipment. Correct
As the world' worlds human population becomes larger, we may need to take several steps to solve our critical food supply problem. Which is only a short-term solution?

Choose one answer.
a. Continually improving locally adapted plant varieties.
b. Animals raised for meat could graze on marginal land instead of being fed grain.
c. Food producing nations could give their excess to poor nations.
d. Use of plant nutrients could be made more efficient.
c. Food producing nations could give their excess to poor nations.
Population centers and agriculture in the arid Great Plains have grown rapidly in recent years. As a result, what has been the environmental impact?
Choose one answer.
a. dramatic lowering of aquifers
b. decreased humidity in cities
c. decreased use of fuel stores
d. increase genetic diversity in crop plants
a. dramatic lowering of aquifers
The "Green Revolution":
Choose one answer.
a. is a cycle plants go through each year before producing flowers.
b. is a change in agricultural techniques resulting in higher yields.
c. resulted in greater genetic diversity in crops.
d. is an environmental movement of the 1960s.
. is a change in agricultural techniques resulting in higher yields.
Traditional agricultural cropping systems often are more ecologically and economically stable because they:
Choose one answer.
a. have no disease or insect pests such as with more industrial agriculture.
b. frequently use mixtures of many crops in the same area sharing similar resources.
c. depend only on plants that have been highly developed for extreme productivity.
d. never plant the same crop in the same area in successive years.
b. frequently use mixtures of many crops in the same area sharing similar resources.
Traditional agricultural methods as practiced in less developed countries:
Choose one answer.
a. are used on extremely large farms.
b. generally don't include use of sophisticated farm machinery.
c. are not labor intensive.
d. include the extensive use of pesticides.
. generally don't include use of sophisticated farm machinery.
What do traditional farmers of developing nations have to contribute to the genetic research of developed nations?
Choose one answer.
a. increased agricultural labor force
b. local land races
c. water for irrigation
d. large areas of uncultivated land
b. local land races
What is the problem with annual, monoculture cropping practices?
Choose one answer.
a. Only small family farms can productively grow these high-yielding varieties.
b. All individuals in the crop are essentially genetically identical and vulnerable to disaster.
c. Conservation tillage systems cannot be used.
d. They can only be carried out in developing countries.
e. The yields are low when high inputs of water, fertilizers, and pesticides are applied.
b. All individuals in the crop are essentially genetically identical and vulnerable to disaster
When producing food crops, the environment the plants are to be grown in must be considered because:
Choose one answer.
a. the environment may cause the plant to mutate if its not exactly right.
b. it may differ from the one in which they evolved and therefore be unsuitable.
c. if its not right, fertilizer may have to be used.
d. plants can only grow in the exact environment in which they evolved.
b. it may differ from the one in which they evolved and therefore be unsuitable
Which agricultural practice is likely to provide the most sustainable defense against pests?
Choose one answer.
a. Create the "ultimate" pesticide.
b. Use fewer, better-researched crop species.
c. Widespread use of crops that are genetically engineered by U.S. businesses.
d. Increase crop diversity.
d. Increase crop diversity.
Which decreases with modern agricultural practices?
Choose one answer.
a. proportion of people with agricultural knowledge in society
b. soil compaction
c. capital investment
d. irrigation
a. proportion of people with agricultural knowledge in society
Which has NOT been the result of the crop breeding?
Choose one answer.
a. increased soil fertility
b. uniform plants
c. increased yield
d. disease resistance
a. increased soil fertility
Which is NOT a characteristic of modern agricultural techniques?
Choose one answer.
a. Is human labor intensive.
b. Relies on pesticides.
c. Has resulted in the evolution of pesticide-resistant pests.
d. Is dependent on use of fossil fuels.
a. Is human labor intensive.
Which is TRUE concerning polycultures compared to monocultures in agriculture? They:
Choose one answer.
a. will be less likely to suffer great loss from one disease.
b. provide a larger, more easily found target for herbivores.
c. deplete the soil of nutrients faster.
d. have a lower amount of genetic variability.
a. will be less likely to suffer great loss from one disease
Which of the following is TRUE?
Choose one answer.
a. All countries that cannot grow corn, soybeans, wheat or rice import them.
b. All cash crops are food crops.
c. Developing countries are more concerned in producing food crops rather than cash crops.
d. All developing countries could make use of modern agricultural practices.
e. A greater portion of the population in developing countries are involved in agriculture than in developed countries.
e. A greater portion of the population in developing countries are involved in agriculture than in developed countries
Which statement about the "Green Revolution" is TRUE?
Choose one answer.
a. Selective breeding for high yield crops has decreased the capital investment for farmers.
b. As a result of the Green Revolution, the standard of living has been raised substantially in some parts of the world.
c. The Green Revolution has slowed the movement of populations to the cities.
d. The Green Revolution has resulted in more equitable land distribution among all classes.
e. Many developing nations have switched from cash crop cultivation to food crops.
As a result of the Green Revolution, the standard of living has been raised substantially in some parts of the world
Which statement about the Industrial Agricultural practices is TRUE?
Choose one answer.
a. Many developing nations have switched from cash crop cultivation to food crops.
b. Selective breeding for high yield crops has decreased the capital investment for farmers.
c. As a result of these practices, the standard of living has been raised substantially in some parts of the world.
d. They have resulted in more equitable land distribution among all classes.
As a result of these practices, the standard of living has been raised substantially in some parts of the world.
Which statement about the production and use hybrid seed plants is TRUE?
Choose one answer.
a. Breeding programs result in the use of genetically diverse plant varieties.
b. The widespread use of hybrids has led to the extinction of local varieties.
c. Crop breeding leads to hybrids that give high yields without the use of fertilizers.
d. Modern crop varieties cannot be used for further breeding.
b. The widespread use of hybrids has led to the extinction of local varieties
Which statement comparing Illinois agriculture to the traditional agriculture of developing countries is TRUE?
Choose one answer.
a. Little fertilizer is used on Illinois fields.
b. Traditional agriculture is less labor-intensive.
c. In Illinois, farmers make up a smaller proportion of the population.
d. Illinois fields are left fallow (unused) for longer periods of time.
c. In Illinois, farmers make up a smaller proportion of the population.
Which statement genetic resources is FALSE?
Choose one answer.
a. Wild populations have potential for increasing the genetic variation available for plant breeding.
b. Habitat preservation can maintain the wild relatives of crop plants.
c. Pharmaceutical products are potentially present in undescribed species in many habitats.
d. Wild relatives cannot breed with our crop plants and are of no use for crop breeding programs.
e. Seed banks are useful for maintaining varieties of crop plants used in agriculture.
Wild relatives cannot breed with our crop plants and are of no use for crop breeding programs. Correct
Which statement is true about food aid?
Choose one answer.
a. It can cause more harm than good during times of non-disaster.
b. It helps farmers in the receiving country drive up their prices.
c. It is non-political distributed to all countries equally.
d. It is beneficial for all countries that receive it.
It can cause more harm than good during times of non-disaster.
Which statement related to industrial agricultural practices is FALSE?
Choose one answer.
a. Hybrid crop plants require greater amounts of fertilizer and water than do traditional crop plants.
b. Crop breeding has not been successful in increasing crop yield.
c. Tilling can lead to soil erosion, air pollution and stream siltation.
d. Seed banks are useful for maintaining varieties of crop plants used in agriculture.
Crop breeding has not been successful in increasing crop yield
Why are plant breeders constantly developing new varieties of "Green Revolution" crops?
Choose one answer.
a. To provide improved resistance to new pests and pathogens.
b. To maintain genetic diversity.
c. To reduce energy use.
d. To lessen the reliance on specialized mechanization.
e. To facilitate crop rotation and the restoration of fertility to the soil.
To provide improved resistance to new pests and pathogens.
Why is it important to locate and preserve local crop varieties such as heirloom seeds?
Choose one answer.
a. Heirloom seeds give a higher yield than hybrid varieties in all environmental conditions.
b. Local varieties are more dependent on fertilizer application than hybrid varieties.
c. They may contain a diversity of traits that will someday be useful to breeders.
d. Heirloom seeds give a higher yield than hybrid varieties in all environmental conditions.
e. Local varieties are better because they haven't been subjected to natural selection.
They may contain a diversity of traits that will someday be useful to breeder
A body of water that is eutrophic:
Choose one answer.
a. is limited in growth by a lack of nutrients.
b. experiences an initial increase of algal growth.
c. has a large population of large fish.
d. has increased oxygen content due to the action of decomposers.
experiences an initial increase of algal growth.
Acid rain is a result of:
Choose one answer.
a. Fertilizer run-off from fields.
b. Leaching of nitrogen compounds from sewage and septic systems.
c. Over use of laundry detergent.
d. Dead zone formation in the Gulf of Mexico.
e. Burning of fossil fuels.
e. Burning of fossil fuels.
Arrange the following events in a sequence which best describes eutrophication.
1. Nutrients become available by runoff form nearby fields.
2. Increased primary producer populations
3. Increased decomposer populations
4. Decreased oxygen production
5. Buildup of toxic compounds
Choose one answer.
a. 1, 2, 4, 3, 5
b. 1, 4, 2, 3, 5
c. 1, 5, 4, 3, 2
d. 1, 2, 3, 4, 5
d. 1, 2, 3, 4, 5
As a lake becomes eutrophic, one might expect a temporary increase in:
Choose one answer.
a. none of the populations.
b. populations of all higher trophic levels.
c. total primary production.
d. dissolved oxygen at night.
c. total primary production.
Atmospheric nitrogen is fixed in several ways for plant use. Which of the following is NOT one of these ways?
Choose one answer.
a. nitrogen-fixing bacteria
b. decomposition of organic compounds
c. lightning and volcanoes
d. leaching from weathered rocks and minerals
d. leaching from weathered rocks and minerals
Blooms of toxic algae are a result of which?
Choose one answer.
a. Nutrient loading of the rivers emptying into the Atlantic ocean
b. Ecosystem changes in the Gulf of Mexico
c. Irrigation of agricultural fields in California
d. Loss of biodiversity in coniferous forests in Canada
Nutrient loading of the rivers emptying into the Atlantic ocean
Cattails have invaded the Everglades and changed community structure because:
Choose one answer.
a. the Everglades have been drained for flood control.
b. the cattails were introduced and left behind their native diseases and herbivores.
c. urban sprawl has changed the abiotic environment.
d. increases in phosphorus due to agricultural runoff made conditions more favorable for cattails than saw grass.
increases in phosphorus due to agricultural runoff made conditions more favorable for cattails than saw gras
Dead Zones are the result of:
Choose one answer.
a. heavy metal accumulation in the algal population.
b. ocean water with low oxygen content.
c. hurricanes passing over ocean water reducing water pressure.
d. over fishing.
ocean water with low oxygen content.
How does acid rain change community structure?
Choose one answer.
a. Acid-sensitive species are replaced by those not so sensitive to low pH.
b. Nitrogen saturation increases fast growing species at the expense of other species.
c. Increased nutrient flow causes an increase in primary productivity.
d. Death and replacement of species near industry that produce pollution that causes acid rain.
Acid-sensitive species are replaced by those not so sensitive to low pH.
How does the conversion of wetlands to farmland contribute to nitrogen loading in the environment?
Choose one answer.
a. Without wetlands, more N2 is leached from farmland.
b. Wetlands allow more nitrogen run-off into streams.
c. Wetland plants break down nitrogen compounds into a more toxic form than farm crops.
d. Without resident time in wetlands, there is less time for bacterial breakdown of nitrogen compounds.
Without resident time in wetlands, there is less time for bacterial breakdown of nitrogen compounds.
How have humans altered the natural nitrogen cycle?
Choose one answer.
a. The burning of fossil fuels
b. The growing of nitrogen-fixing crops
c. Through the use of synthetic nitrogen fertilizers
d. All of the above
e. The runoff of animal wastes from feedlots
d. All of the abov
Hypoxic areas that develop in the Gulf of Mexico can be connected to:
Choose one answer.
a. normal fluxes within the ecosystem.
b. oligotrophication of the Illinois and Mississippi rivers.
c. nitrogen runoff from Midwest farms into the Mississippi.
d. increase in shrimp populations.
nitrogen runoff from Midwest farms into the Mississippi.
In a pond that is NOT eutrophic, growth of algae populations is most limited by which factor?
Choose one answer.
a. oxygen.
b. herbivores.
c. nutrients.
d. disease.
c. nutrients.
One disadvantage of the use of inorganic fertilizer added in agricultural fields is that it:
Choose one answer.
a. is dilute and bulky.
b. is easily leached into the surrounding environment.
c. is rapidly available.
d. requires decomposition by bacteria.
b. is easily leached into the surrounding environment.
Plant species diversity is naturally low in the Everglades of Florida because of:
Choose one answer.
a. a high number of available niches.
b. invasion of non-native species.
c. presence of a keystone species, the mangrove tree.
d. the stress of low nutrient availability.
. the stress of low nutrient availability
The Everglades has been invaded by cattails because:
Choose one answer.
a. draining of the Everglades for agriculture favors the cattails over the normal Everglades community.
b. cattails have escaped from nearby farms out-competing the normal Everglades community.
c. habitat destruction has resulted an increase in light levels destroying the normal Everglades community.
d. an increase in phosphorus fertilizer is stressful for the normal Everglades community.
d. an increase in phosphorus fertilizer is stressful for the normal Everglades community.
The most immediate end result of eutrophication is a decrease in:
Choose one answer.
a. oxygen.
b. carbon dixoide.
c. primary producers.
d. phosphorus.
a. oxygen
The reason fish die and community structure changes as a result of eutrophication (the process that produces regions like the "dead zone" in the Gulf of Mexico) is:
Choose one answer.
a. pollution causes invertebrates to die.
b. excessive carbon dioxide accumulates.
c. toxic substances are released by algae.
d. decomposers use up oxygen.
d. decomposers use up oxyge
The upwelling of nutrient rich, but oxygen poor, water from the deep oceans can cause:
Choose one answer.
a. dead zones.
b. green tides.
c. sea otter population booms.
d. denitrification.
a. dead zones.
What actions primarily cause the dead zone in the Gulf of Mexico?

Choose one answer.
a. fertilizer run off from farms in the Mid-west
b. introduction of invasives from the Great Lakes region
c. industrial combustion and emission of pollutants
d. effluent run off from cattle farming in California
a. fertilizer run off from farms in the Mid-west
Where do Dead Zones occur and why?
Choose one answer.
a. Dead Zones are the result of oil spills and can be on land or at sea.
b. Dead Zones are ocean areas near the mouths of rivers where the ecosystem has collapsed.
c. Dead Zones are a description of the dead bodies that surround toxic watering holes.
d. Dead Zones are ocean areas that are devoid of fish from over-harvesting.
Dead Zones are ocean areas near the mouths of rivers where the ecosystem has collapsed
Where do green plants get their phosphorus?
Choose one answer.
a. Through emissions from deep seafloor vents.
b. The fixation of inorganic phosphorus compounds through nitrogen-fixing bacteria.
c. The leaching of phosphorus compounds from weathered rocks and minerals.
d. Through the combustion of fossil fuels.
c. The leaching of phosphorus compounds from weathered rocks and minerals.
Which is NOT a source of nitrogen in the environment?
Choose one answer.
a. fossil fuel combustion
b. manure
c. fertilizer runoff
d. wetland construction
e. meat consumption
fossil fuel combustion
Which is NOT an effect of nitrogen pollution?
Choose one answer.
a. decreased crop yields
b. eutrophication of lakes and coastal areas
c. unsafe levels of nitrates in drinking water
d. loss of biodiversity in terrestrial and aquatic ecosystems
e. acidification of forest soils
decreased crop yields
Which may be one impact of human-driven nitrogen fixation?

Choose one answer.
a. Through increasing plant growth, atmospheric carbon dioxide is increased.
b. Produces the precursors to smog and ground-level ozone.
c. Reduction in the occurrence of acid rain.
d. Nitrogen is fixed into the soil leaving stream water cleaner.
Produces the precursors to smog and ground-level ozone.
Which of the following statements about acid rain is true?
Choose one answer.
a. Acid, in the form of vinegar, is formed from gases from cows.
b. Acid rain affects plants by changing the soil nutrient availability.
c. Acid rain is a local phenomenon; that is the pollution that causes it is produced in the same place it has its effect.
d. One solution to the problem of acid rain is the use of tall smokestacks to dilute the polluting chemicals.
Acid rain affects plants by changing the soil nutrient availability
Which of the following would result directly in the depletion of available oxygen in a body of water?
Choose one answer.
a. The growth of algal populations.
b. The destruction of marshes and wetlands.
c. The addition of chemical nutrients to a water system.
d. Bacterial decomposition of a large amount of dead algal cells.
Bacterial decomposition of a large amount of dead algal cells.
Which plant is a native invasive causing community disruption in the Everglades?
Choose one answer.
a. kudzu
b. honeysuckle
c. cattails
d. switch grass
c. cattails
Which statement about nutrient pollution is TRUE?
Choose one answer.
a. Fertilizer runoff is the main cause of high nitrogen loading in all parts of the world.
b. Nitrogen loading leads to the acidification of the environment.
c. Dead Zones are a problem only in the Americas.
d. Consumer choices make no difference in the amount of nutrients in the environment.
b. Nitrogen loading leads to the acidification of the environment.