How can we help?

You can also find more resources in our Help Center.

74 terms

Genetics Test 3

STUDY
PLAY
T/F Messenger RNA is usually polycistronic in eukaryotes
False
T/F Heterogeneous nuclear RNA is a primary transcript in eukaryotes which is processed prior to involvement in translation
True
T/F Proteins are composed of strings of nucleotides connected together by 5'-3' phosphodiester bonds
False
T/F The secondary structure of a protein is dependent on polar interactions among the side chains of the amino acids
False
Alpha-Helix and Beta-Sheet
secondary protein structures
5' to 5' triphospate
Linkage found at the front-end of Pol II transcripts
intron
non-coding sequence
exon
coding sequence
polynucleotide phosphorylase
degradation of RNA
Which of the following two terms relates most closely to split genes?
a) 5'-cap, 3'-poly-A tail
b) introns, exons
c) elongation, termination
d) transcription, translation
e) heteroduplex, homoduplex
introns, exons
In 1964, Nirenberg and Leder used the triplet binding assay to determine specific codon assignments. A complex of the following components was trapped in the nitrocellulose filter?
charged tRNA, RNA triplet, and ribosome
The primary structure of a protein is determined by
a) the sequence of amino acids
b) hydrogen bonds formed between the components of the peptide linkage
c) a series of helical domains
d) pleated sheets
e) covalent bonds
the sequence of amino acids
An initiation factor can function to do the following during prokaryotic translation
enhances binding of formylmethionyl tRNA to the small subunit
When one speaks of a 5' cap, one is usually describing
addition of guanine to the 5' end of an mRNA
Nutritional mutations can be defined as
all strains which are not auxotrophic
What is the type of mutation shown?
wild type: met-trp-tyr-arg-gly-ser-pro-thr
mutant: met-trp
nonsense mutation
What is the type of mutation shown?
wild type: met-trp-tyr-arg-gly-ser-pro-thr
mutant: mert-trp-his-arg-gly-ser-pro-thr
missense mutation
What is the type of mutation shown?
wild type: met-trp-tyr-arg-gly-ser-pro-thr
mutant: met-cys-ile-val-val-val-gin-his
frameshift mutation
phosporylation of pRB is carried out by
CDK4/cyclin D
The transcription factor that controls expression of genes required for S-phase is
E2F
One difference between DNA and RNA polymerases is the ability of RNA polymerase to?
Initiate
Which of the following terms best describes catabolite repression associated with the E. coli lac operon?
positive control
When referring to attenuation in regulation of the tryptophan operon it would be safe to say that when there are high levels of tryptophan available to the organism . . .
transcriptional termination is likely
In the presence of lactose only, Predict the whether the structural genes of the operon are -constitutive-
I-O+Z+, I+OcZ+, I+OcZ+/F'O+
In the presence of lactose only, Predict the whether the structural genes of the operon are -permanently repressed-
IsO+Z+
In the presence of lactose only, Predict the whether the structural genes of the operon are -inducible-
I+O+Z+, I-O+Z+/F'I+
Which of the following is a positive regulator of the lac operon?
a) allolactose
b) beta-galactosidase
c) CAP-cAMP
d) all of the above
CAP-cAMP
Given the following sequence, predict the number of amino acids in the most probable polypeptide produced during translation in a prokaryotic cell?
ACCAUGGGGAGGAUGUUCAAUGAUGCUGGC
UGUUAUUAUUGAUAUUAACAUGUGUUGA
9
The correct order of for the assembly of the eukaryotic transcription complex is:
TFID,TFIIB,TFIIF,TFIIE,TFIIH
Examples of postranslational modification include
a) removal of signal sequences
b) phosphorylation and methylation
c) complexing with metal ions
d) addition of carbohydrates
e) all of the above
all of the above
Which of the following transcription factors binds the TATA sequence in eukaryotic promoters?
TFIID
Which of the following transcription factors positions RNA polymerase at prokaryotic promoters?
sigma factor
A mutation that results in a switch from a purine-pyrimidine base pair to a pyrimidine-purine base pair is a ______ mutation
transversion
Which of the following are characteristic of polycistronic RNAs
encodes two or more polypeptides
The term peptidyltransferase relates to
peptide bond formation during protein synthesis
Considering the structure of double-stranded DNA, what kinds of bonds link the nitrogenous bases on the on the complementary strands?
hydrogen
The two major components of the Tobacco mosaic virus are?
RNA and protein
Which histone protein attaches to DNA strands between nucleosomes
H1
Chromatin in eukaryotes is organized into repeating interaction with protein octamers called nucleosomes. Nucleosomes are composed of
histones
A nonhistone protein found in chromatin?
HMG
Eukaryotic chromosomes contain two general domains that relate to the degrees of condensation. These two regions are
separated by large stretches of repetitive DNA
The correct order of activity in replication
Helicase, SSB, primase, Pol III, Pol I, ligase
DNA polymerase catalyzes the formation of a bond between the
3'OH group of one nucleotide and the 5' phosphate of the next
Which of the following enzymes initiates chain synthesis on a template during replication?
primase
DNA synthesis in eukaryotes is
semi-conservative
Actually synthesizes RNA not DNA
primase
Contains an RNA molecule which is required to finction
Telomerase
Prevents reassociation of the DNA helix
SSB
Opens the double helix for replication machinery
helicase
Elongation of a DNA chain
DNA Pol III
The basic structure of a nucleotide includes the following components
Base, sugar, phosphates
The core nucleosome consists of which of the following?
2xH2A, 2xH2B,2xH3,2xH4
What about RNA polymerase is not true?
RNA normally transcribes both strands of DNA during the expression of a gene
What is a mechanism that allows a single gene to encode more than one polypeptide?
Alternative RNA splicing
If the sequence of an RNA molecule is 5'-GGCAUCGACG-3', what is the sequence of the template strand of DNA?
3'-CCGTAGCTGC-5'
During gene expression, which molecule carries the information that encodes polypeptides?
mRNA
If the sequence of a nontemplate strand of DNA is 5'-ACCGCATCCGAGTCAC-3' what is the sequence of the primary product of transcription?
5'-ACCGCAUCCGAGUCAC-3'
The DNA enzyme that most closely resembles RNA polymerase is
primase
When this molecule is synthesized, both strands of DNA are used as a template
DNA only
This molecule is synthesized using triphosphate nucleotides as a substrate for a polymerase enzyme that forms phosphodiester bonds
both DNA and RNA
This molecule is synthesized using nucleotides containing the bases A G C U
RNA only
This molecule is made of nucleotides joined by phosphodiester bonds that connect the 2'-OH to the 5'-phosphate
neither RNA or DNA
Unwinds the double helix
helicase
Prevents reassociation of complementary bases
SSB protein
Is DNA dependent RNA polymerase
Primase
Is DNA dependent DNA polymerase
Polymerase I
Is the polymerase involved in DNA repair
Polymerase I
Is the major elongation factor
Polymerase III
Has a 5'-3' exonuclease function
Polymerase I
Forms phosphodiester bonds between free 3'-OH of a polynucleotide to free 5' monophosphate end of a polynucleotide
Ligase
Which of the following is not true for all E. coli DNA polymerases?
They posses 5'-3' exonuclease activity
Which ability is not associated with DNA polymerases?
Ability to initiate DNA from scratch without a primer
The activity of which enzyme or protein would be needed latest in DNA synthesis?
DNA ligase
Which statement about the genetic code is not true?
Each species of organisms has its own unique genetic code