Among the structurally simplest riboswitches are the two so-called purine riboswitches, one of which responds to guanine, and the other to adenine. The accompanying diagram shows a guanine riboswitch. Base-pairing between free guanine and a particular cytosine residue within the aptamer determines the riboswitch conformation.

a. What condition in the cellular environment would favor each of the riboswitch configurations?

b. In B. subtilis, guanine riboswitches are located in 5 different transcription units containing 17 different genes. Based on the diagram and your answer to part (a), what biological processes do you think these 17 genes might be involved in? Explain your reasoning.

Figure shows that in the lac operon, both the operator $\left(\mathrm{o}_1\right)$ and the binding site for $\mathrm{CRP}-\mathrm{cAMP}$ show rotational symmetry. This is not true of the promoter (the RNA polymerase binding site) as a whole. Why do you think the promoter does not exhibit rotational symmetry?

In many bacterial species, regulatory sRNAs have been identified by transcriptome sequencing (RNASeq). How do researchers know that the small RNA species identified by cDNA sequencing are regulatory sRNAs rather than fragments of longer mRNAs?

To find genes that are turned on or off in response to changes in osmolarity (the total concentration of solutes in solution), you grow a culture of E. coli in a medium with high osmolarity and another culture in a medium with low osmolarity. You now perform RNA-Seq analysis on each culture. It is possible that osmotic changes may induce a general stress response that may be seen with other stresses as well (for example, heat shock). How could you distinguish the genes that might be involved in a general stress response from those that are specific for the osmolarity change?

In 2005, Frederick Blattner and his colleagues found that E. coli have a global transcriptional program that helps them "forage" for better sources of carbon. Many genes, including genes needed for bacterial motility, are turned on in response to poorer carbon sources so that the bacteria can search for better nutrition. You now want to search for genes that regulate this response. How could you use lacZ fusions to try to identify such regulatory genes?

The following is a sequence of the leader region of the his operon mRNA in Salmonella typhimurium. What bases in this sequence could cause a ribosome to pause when histidine is limiting (that is, when there is very little of it) in the medium?

5' AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCACCUGACUAGUCUUUCAGGC $3^{\prime}$

Both attenuation and riboswitches rely on changes in the secondary structure of the leader regions of mRNA to regulate gene expression. Compare and contrast the specific mechanisms in these two types of regulation.

In an effort to determine the location of an operator site for a negatively regulated gene, you have made a series of deletions within the regulatory region. The extent of each deletion is shown by the line underneath the sequence, and the resulting expression from the operon (i = inducible; c = constitutive; - = no expression is also indicated).

. . . G G A T C T T A G C C G G C T A A C A T G A T A A A T A T A A . .

. . C C T A G A A T C G G C C G A T T G T A C T A T T T A T A T T . .

a. What can you conclude from these data about the location of the operator site?

b. Why do you think deletions 2 and 4 show no expression?

Researchers know that Fru-M controls male sexual behavior in Drosophila because inappropriate Fru-M expression in females causes them to behave like males: Such females display male behaviors that are oriented toward other females. a. Describe a fru mutation that could cause expression of Fru-M in females. b. Describe a gene construct that scientists could generate and insert into Drosophila females that would have the same effect as the mutant you described in (a).

a. The original constitutive operator mutations in the lac operon were all base changes in $O_{1} .$ Why do you think mutations in $O_{2}$ or $O_{3}$ were not isolated in these screens? b. Explain how a mutagen that causes small insertions could produce an $O^{c}$ mutation. c. Would the $O^{c}$ mutation described above in part b be sensitive to $\mathrm{lacl}^{s} ?$ Why or why not?

Scientists have exploited the siRNA pathway to perform a technique called RNA interference a means to knock out the expression of a specific gene. without having to make mutations in it. The idea is to introduce dsRNA corresponding to the target gene into an organism; the dsRNA is then processed into an siRNA that leads to the degradation of the target gene's mRNA. One clever method for delivery of the dsRNA to some organisms (the nematode C. elegans, for example) is to feed them bacteria transformed with a recombinant plasmid that expresses dsRNA. a. Draw a gene construct that, when expressed from a plasmid in bacteria, could be used to knock out the expression of gene X of C. elegans. b. How can you test if gene X expression is obliterated in worms that have eaten the bacteria transformed with a plasmid containing your construct? c. Do you think that only gene X expression will be affected in these worms? Explain.

By searching a human genomic database, you have found a gene that encodes a protein with weak homology to Argonaute, a factor present in complexes that bind to certain miRNAs and mediate the ability of these miRNAs to regulate the stability or translation of target mRNAs (review Figs. 16.25 and 16.26 on p. 563). a. How would you determine which specific miRNAs night be associated with the new protein you discovered? (Think about how you might use a variation of the ChIP-Seq technique described in Fig, 16.17 on p. 556 to explore this question.) b. If a mouse could be obtained that was homozygous for a null mutation of the mouse gene almost identical to the human gene you found, how could you use this mutant mouse to ask what mRNAs might be targeted by the miRNA-RISC complexes containing your Argonaute-like protein?

In Drosophila subobscura, the presence of a recessive gene called grandchildless $(\mathrm{gs})$ causes the offspring of homozygous females, but not those of homozygous males, to be sterile. Can you offer an explanation as to why females and not males are affected by the mutant gene?

You are studying a transgenic mouse strain that expresses a GFP reporter gene under the control of cisacting regulatory elements that normally control a gene needed for the early development of mice. Previous evidence from transcriptome sequencing (RNA-seq) indicates that mRNA for the gene of interest can be identified between days 8.5 and 10.5 of gestation. In your strain, GFP fluorescence can be seen from about day 8.75 until at least day 12. a. Explain the discrepancy between mRNA and protein expression. b. Would you expect GFP protein expression to indicate more accurately the normal onset of activity for this gene or the normal cessation of this gene's activity? Explain.