Compare the forms of speciation that are slow with those that occur more rapidly. Make a list of the slow and fast forms. With regard to mechanisms of genetic change, what features do slow and rapid speciation have in common? What features are different?

When comparing the coding region of structural genes among closely related species, it is commonly found that certain regions of the gene have evolved more rapidly (i.e., have tolerated more changes in sequence) than other regions of the gene. Explain why different regions of a structural gene evolve at different rates.

Which would you expect to exhibit a faster rate of evolutionary change, the nucleotide sequence of a gene or the amino acid sequence of the encoded polypeptide of the same gene? Explain your answer.

Would the rate of deleterious or beneficial mutations be a good molecular clock? Why or why not?

If a researcher used genetic engineering techniques to express the Drosophila eyeless gene in the embryo at the region that will become the tip of the mouse's tail, what results would you expect in the resulting offspring?

What is meant by the term molecular clock? How is this concept related to the neutral theory of evolution?

Genes are sometimes transferred between different species via horizontal gene transfer. Discuss how horizontal gene transfer might give misleading results when constructing a phylogenetic tree. How could you overcome this problem?

The following are two DNA sequences from homologous genes:
TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA
GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT
The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.

Discuss how the principle of parsimony can be used in a cladistics approach to constructing a phylogenetic tree.

Discuss the major differences among allopatric, parapatric, and sympatric speciation.

A team of researchers has obtained a dinosaur bone (Tyrannosaurus rex) and has attempted to extract ancient DNA from it. Using primers to the $12 \mathrm{~S}$ rRNA mitochondrial gene, they have used PCR and obtained a DNA segment that yields a sequence homologous to crocodile DNA. Other scientists are skeptical that this sequence is really from the dinosaur. Instead, they believe that it may be due to contamination from more recent DNA, such as the remains of a reptile that lived much more recently. What criteria might you use to establish the credibility of the dinosaur sequence?

Discuss whether the phenomenon of reproductive isolation applies to bacteria, which reproduce asexually. How would a geneticist divide bacteria into separate species?

Discuss the evidence in favor of the punctuated equilibrium model of evolution. What mechanisms could account for this pattern of evolution? In contrast, what type of genetic changes are consistent with gradualism?

We learned about a technique called fluorescence in situ hybridization (FISH), during which a labeled piece of DNA is hybridized into a set of chromosomes. Let's suppose that we cloned a piece of DNA from G. pubescent and used it as a labeled probe for in situ hybridization. What would you expect to happen if we hybridized it to the G. speciosa, the natural G. tetrahit, or the artificial G. tetrahit strains? Describe your expected results.