If you were comparing the karyotypes of species that are closely related evolutionarily, what types of similarities and differences would you expect to find?

Take a look at the $\alpha$-globin and $\beta$-globin sequences. Which sequences are more similar, the $\alpha$ globin in humans and the $\alpha$ globin in horses, or the $\alpha$ globin in humans and the $\beta$ globin in humans? Based on your answer, would you conclude that the gene duplication that gave rise to the $\alpha$-globin and $\beta$-globin genes occurred before or after the divergence of humans and horses? Explain your reasoning.

Evolution, which involves genetic change in a population of organisms over time, is often described as the unifying theme in biology. Discuss how evolution is unifying at the molecular and cellular levels.

Compare the forms of speciation that are slow with those that occur more rapidly. Make a list of the slow and fast forms. With regard to mechanisms of genetic change, what features do slow and rapid speciation have in common? What features are different?

Sympatric speciation by allotetraploid has been proposed as a common mechanism for speciation. Let's suppose you were interested in the origin of certain grass species in southern California. Experimentally, how would you go about determining if some of the grass species are the result of allotetraploid?

Aphylogenetic tree of all life on Earth based on $16 \mathrm{~S}$ rRNA data. Based on your understanding of molecular genetics (in this and other chapters), describe three or more observations that suggest that all life-forms on Earth evolved from a common ancestor or group of ancestors.

Plant seeds contain storage proteins that are encoded by plant genes. When the seed germinates, these proteins are rapidly hydrolyzed (i.e., the covalent bonds between amino acids within the polypeptides are broken), which releases amino acids for the developing seedling. Would you expect the genes that encode plant storage proteins to evolve slowly or rapidly compared with genes that encode enzymes? Explain your answer.

When comparing the coding region of structural genes among closely related species, it is commonly found that certain regions of the gene have evolved more rapidly (i.e., have tolerated more changes in sequence) than other regions of the gene. Explain why different regions of a structural gene evolve at different rates.

Which would you expect to exhibit a faster rate of evolutionary change, the nucleotide sequence of a gene or the amino acid sequence of the encoded polypeptide of the same gene? Explain your answer.

Would the rate of deleterious or beneficial mutations be a good molecular clock? Why or why not?

What is meant by the term molecular clock? How is this concept related to the neutral theory of evolution?

If a researcher used genetic engineering techniques to express the Drosophila eyeless gene in the embryo at the region that will become the tip of the mouse's tail, what results would you expect in the resulting offspring?

The following are two DNA sequences from homologous genes:
TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA
GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT
The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.

Genes are sometimes transferred between different species via horizontal gene transfer. Discuss how horizontal gene transfer might give misleading results when constructing a phylogenetic tree. How could you overcome this problem?