In 2005, Frederick Blattner and his colleagues found that E. coli have a global transcriptional program that helps them "forage" for better sources of carbon. Many genes, including genes needed for bacterial motility, are turned on in response to poorer carbon sources so that the bacteria can search for better nutrition. You now want to search for genes that regulate this response. How could you use lacZ fusions to try to identify such regulatory genes?

In many bacterial species, regulatory sRNAs have been identified by transcriptome sequencing (RNASeq). How do researchers know that the small RNA species identified by cDNA sequencing are regulatory sRNAs rather than fragments of longer mRNAs?

One mechanism by which antisense RNAs act as negative regulators of gene expression is by base pairing with the ribosome binding site on the "sense" mRNA to block translation. In a second, alternative mechanism, the act of transcribing an antisense RNA can somehow prevent RNA polymerase from recognizing the sense promoter for the same gene. Design an experimental approach that would enable you to distinguish between these two modes of action at a specific gene. (Hint: What would be the outcome in each case if high levels of the antisense RNA were transcribed from a gene on a plasmid?)

Describe how RNA-Seq analysis could have been used to discover the components of the $V$. fischeri quorum-sensing pathway. Would any of the components of the pathway shown in Fig. 16.33 have escaped detection? Explain.

What is the midpoint of the segment connecting the points (-3, -4) and (4, 3)?

To find genes that are turned on or off in response to changes in osmolarity (the total concentration of solutes in solution), you grow a culture of E. coli in a medium with high osmolarity and another culture in a medium with low osmolarity. You now perform RNA-Seq analysis on each culture. It is possible that osmotic changes may induce a general stress response that may be seen with other stresses as well (for example, heat shock). How could you distinguish the genes that might be involved in a general stress response from those that are specific for the osmolarity change?

The following is a sequence of the leader region of the his operon mRNA in Salmonella typhimurium. What bases in this sequence could cause a ribosome to pause when histidine is limiting (that is, when there is very little of it) in the medium?

5' AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCACCUGACUAGUCUUUCAGGC $3^{\prime}$

a. How many ribosomes are required (at a minimum) for the translation of $\operatorname{trp} E$ and $\operatorname{trp} C$ from a single transcript of the $\operatorname{trp}$ operon?

b. How would you expect deletion of the two tryptophan codons in the RNA leader to affect the expression of the $\operatorname{trp} E$ and $\operatorname{trp} C$ genes?

a. The original constitutive operator mutations in the lac operon were all base changes in $O_{1} .$ Why do you think mutations in $O_{2}$ or $O_{3}$ were not isolated in these screens? b. Explain how a mutagen that causes small insertions could produce an $O^{c}$ mutation. c. Would the $O^{c}$ mutation described above in part b be sensitive to $\mathrm{lacl}^{s} ?$ Why or why not?

In an effort to determine the location of an operator site for a negatively regulated gene, you have made a series of deletions within the regulatory region. The extent of each deletion is shown by the line underneath the sequence, and the resulting expression from the operon (i = inducible; c = constitutive; - = no expression is also indicated).

. . . G G A T C T T A G C C G G C T A A C A T G A T A A A T A T A A . .

. . C C T A G A A T C G G C C G A T T G T A C T A T T T A T A T T . .

a. What can you conclude from these data about the location of the operator site?

b. Why do you think deletions 2 and 4 show no expression?

Figure shows that in the lac operon, both the operator $\left(\mathrm{o}_1\right)$ and the binding site for $\mathrm{CRP}-\mathrm{cAMP}$ show rotational symmetry. This is not true of the promoter (the RNA polymerase binding site) as a whole. Why do you think the promoter does not exhibit rotational symmetry?

Explain how spiders predigest their food and compare this process to the digestion process of another animal with which you are familiar.

In Drosophila subobscura, the presence of a recessive gene called grandchildless $(\mathrm{gs})$ causes the offspring of homozygous females, but not those of homozygous males, to be sterile. Can you offer an explanation as to why females and not males are affected by the mutant gene?

Researchers know that Fru-M controls male sexual behavior in Drosophila because inappropriate Fru-M expression in females causes them to behave like males: Such females display male behaviors that are oriented toward other females. a. Describe a fru mutation that could cause expression of Fru-M in females. b. Describe a gene construct that scientists could generate and insert into Drosophila females that would have the same effect as the mutant you described in (a).