List all possible codons present in a ribonucleotide polymer containing U and G in random sequence. Which amino acids are encoded by this RNA?

The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in $16$S rRNA residues A$1492$ and A$1493$ as are induced by codon-anticodon. Propose an explanation for the antibiotic effect of paromomycin.

EF-Tu binds all aminoacyl-tRNAs with approximately equal affinity so that it can deliver them to the ribosome with the same efficiency. Based on the experimentally determined binding constants for EF-Tu and correctly charged and mischarged aminoacyl-tRNAs (see table), explain how the tRNA-EF-Tu recognition system could prevent the incorporation of the wrong amino acid during translation.

$$\begin{array}{lc} \text { Aminoacyl-tRNA } & \text { Dissociation Constant (nM) } \\ \hline \text { Ala-tRNA }^{\text {Ala }} & 6.2 \\ \hline \text { Gln-tRNA }^{\text {Ala }} & 0.05 \\ \hline \text { Gln-tRNA }^{\text {Gln }} & 4.4 \\ \hline \text { Ala-tRNA }^{\text {Gln }} & 260 \end{array}$$

The sequence of the sense strand of a mammalian gene is

TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATC-

GTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAG-

GCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGAT-

TAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTA-

AGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATA-

AACGATATCGATCGGTTAGGTAAGTCTGAT

Determine the sequences of the mature RNA and the encoded protein. Assume that transcription initiates at a G approximately $25$ bp downstream of the TATAATA sequence, that each $5′$ splice site has the sequence AG/GUAAGU, and that each $3′$ splice site has the sequence CAG/G (where / marks the location of the splice).

A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-$1$ and vir-$2$. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-$1$) and $5$ residues (vir-$2$).

AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT

(a) Identify the DNA sequence that encodes each peptide.

(b) Determine the amino acid sequence of each peptide.

(c) In a mutant viral strain, the T at position $23$ has been replaced with G. Determine the amino acid sequences of the two peptides encoded by the mutant virus.

The flu virus maximizes the use of its limited $(13.5$ kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a different C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.

-GAUUCCUUUCGUCAGUCCGAGA -

One cause of the neurodegenerative disease amyotropic lateral sclerosis (ALS) is the expansion of the repeating hexanucleotide sequence GGGGCC in the noncoding region of a gene. By unknown mechanisms, the repeating sequence is translated to generate neurotoxic peptides. Predict the sequences of the possible repeating dipeptides.

The peptidyl transferase activity of the ribosome does not require an additional source of free energy. Is the reaction catalyzed by $\gamma$-glutamylcysteine synthetase exergonic?

When a sequence of deoxynucleotides is entered into a translation program (such as the ExPASy Translate tool at http://web.expasy.org/ translate/), six possible polypeptide sequences are given as results. Explain.

Mitochondrial ribosomes manufacture $13$ proteins, all of which are components of the oxidative phosphorylation machinery. Propose an explanation why the peptide exit tunnel of the mitoribosome is lined with hydrophobic groups rather than hydrophilic groups, as in a cytosplasmic ribosome.

The ribosome can transfer any peptidyl group from the P-site tRNA to any aminoacyl group on the A-site RNA, but the rate may vary with the identities of those groups. Propose an explanation why the ribosome synthesizes poly-Pro sequences extremely slowly compared to other peptide sequences.

Eukaryotic initiation factor eIF$2$B is a guanine nucleotide exchange factor. Explain why eIF$2$B would enhance the activity of eIF$2$.

Explain why the translation of a given mRNA can be inhibited by a segment of its complementary sequence, a so-called antisense RNA.

Explain why prokaryotic ribosomes can translate a circular mRNA molecule, whereas eukaryotic ribosomes normally cannot, even in the presence of the required cofactors.