Quorum sensing controls the expression of virulence in many pathogenic bacteria. Usually, pathogens express toxins in response to receptor activation by ligand binding at high cell density. V. cholerae (the causative agent of cholera) does the opposite; its virulence genes are expressed only at low cell density because its quorum-sensing receptor is repressed by Iigand binding. The unusual "reversed'' mechanism for activating virulence genes in V. cholerae has suggested to scientists a simple idea for generating a new kind of antibiotic for the treatment of cholera. Explain.

In many bacterial species, regulatory sRNAs have been identified by transcriptome sequencing (RNASeq). How do researchers know that the small RNA species identified by cDNA sequencing are regulatory sRNAs rather than fragments of longer mRNAs?

To find genes that are turned on or off in response to changes in osmolarity (the total concentration of solutes in solution), you grow a culture of E. coli in a medium with high osmolarity and another culture in a medium with low osmolarity. You now perform RNA-Seq analysis on each culture. It is possible that osmotic changes may induce a general stress response that may be seen with other stresses as well (for example, heat shock). How could you distinguish the genes that might be involved in a general stress response from those that are specific for the osmolarity change?

The human nuclear genome encodes tRNAs with 32 different anticodons (excluding tRNA ${ }^{\mathrm{Sec}}$ that was described in Fig. 8.22). The mitochondrial genome encodes only 22 different tRNAs that are sufficient to translate all mitochondrial mRNAs. The differences in the nuclear and mitochondrial genetic codes (see Table 15.1) are not great enough to explain the difference in the numbers of tRNAs needed in each case. How can the difference be explained? (Hint: Think about the wobble rules shown in Fig. 8.21b.)

In 2005, Frederick Blattner and his colleagues found that E. coli have a global transcriptional program that helps them "forage" for better sources of carbon. Many genes, including genes needed for bacterial motility, are turned on in response to poorer carbon sources so that the bacteria can search for better nutrition. You now want to search for genes that regulate this response. How could you use lacZ fusions to try to identify such regulatory genes?

The following is a sequence of the leader region of the his operon mRNA in Salmonella typhimurium. What bases in this sequence could cause a ribosome to pause when histidine is limiting (that is, when there is very little of it) in the medium?

5' AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCACCUGACUAGUCUUUCAGGC $3^{\prime}$

a. How many ribosomes are required (at a minimum) for the translation of $\operatorname{trp} E$ and $\operatorname{trp} C$ from a single transcript of the $\operatorname{trp}$ operon?

b. How would you expect deletion of the two tryptophan codons in the RNA leader to affect the expression of the $\operatorname{trp} E$ and $\operatorname{trp} C$ genes?

One mechanism by which antisense RNAs act as negative regulators of gene expression is by base pairing with the ribosome binding site on the "sense" mRNA to block translation. In a second, alternative mechanism, the act of transcribing an antisense RNA can somehow prevent RNA polymerase from recognizing the sense promoter for the same gene. Design an experimental approach that would enable you to distinguish between these two modes of action at a specific gene. (Hint: What would be the outcome in each case if high levels of the antisense RNA were transcribed from a gene on a plasmid?)

Many genes whose expression is turned on by DNA damage have been isolated. Loss of function mutations in the lexA gene leads to expression of many of these genes, even when there has been no DNA damage. Would you hypothesize that LexA protein is a positive or negative regulator? Why?

Among the structurally simplest riboswitches are the two so-called purine riboswitches, one of which responds to guanine, and the other to adenine. The accompanying diagram shows a guanine riboswitch. Base-pairing between free guanine and a particular cytosine residue within the aptamer determines the riboswitch conformation.

a. What condition in the cellular environment would favor each of the riboswitch configurations?

b. In B. subtilis, guanine riboswitches are located in 5 different transcription units containing 17 different genes. Based on the diagram and your answer to part (a), what biological processes do you think these 17 genes might be involved in? Explain your reasoning.

Figure shows that in the lac operon, both the operator $\left(\mathrm{o}_1\right)$ and the binding site for $\mathrm{CRP}-\mathrm{cAMP}$ show rotational symmetry. This is not true of the promoter (the RNA polymerase binding site) as a whole. Why do you think the promoter does not exhibit rotational symmetry?

In an effort to determine the location of an operator site for a negatively regulated gene, you have made a series of deletions within the regulatory region. The extent of each deletion is shown by the line underneath the sequence, and the resulting expression from the operon (i = inducible; c = constitutive; - = no expression is also indicated).

. . . G G A T C T T A G C C G G C T A A C A T G A T A A A T A T A A . .

. . C C T A G A A T C G G C C G A T T G T A C T A T T T A T A T T . .

a. What can you conclude from these data about the location of the operator site?

b. Why do you think deletions 2 and 4 show no expression?

a. The original constitutive operator mutations in the lac operon were all base changes in $O_{1} .$ Why do you think mutations in $O_{2}$ or $O_{3}$ were not isolated in these screens? b. Explain how a mutagen that causes small insertions could produce an $O^{c}$ mutation. c. Would the $O^{c}$ mutation described above in part b be sensitive to $\mathrm{lacl}^{s} ?$ Why or why not?

In Drosophila subobscura, the presence of a recessive gene called grandchildless $(\mathrm{gs})$ causes the offspring of homozygous females, but not those of homozygous males, to be sterile. Can you offer an explanation as to why females and not males are affected by the mutant gene?