The following is a sequence of the leader region of the his operon mRNA in Salmonella typhimurium. What bases in this sequence could cause a ribosome to pause when histidine is limiting (that is, when there is very little of it) in the medium?

5' AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCACCUGACUAGUCUUUCAGGC $3^{\prime}$

Many genes whose expression is turned on by DNA damage have been isolated. Loss of function mutations in the lexA gene leads to expression of many of these genes, even when there has been no DNA damage. Would you hypothesize that LexA protein is a positive or negative regulator? Why?

In 2005, Frederick Blattner and his colleagues found that E. coli have a global transcriptional program that helps them "forage" for better sources of carbon. Many genes, including genes needed for bacterial motility, are turned on in response to poorer carbon sources so that the bacteria can search for better nutrition. You now want to search for genes that regulate this response. How could you use lacZ fusions to try to identify such regulatory genes?

a. How many ribosomes are required (at a minimum) for the translation of $\operatorname{trp} E$ and $\operatorname{trp} C$ from a single transcript of the $\operatorname{trp}$ operon?

b. How would you expect deletion of the two tryptophan codons in the RNA leader to affect the expression of the $\operatorname{trp} E$ and $\operatorname{trp} C$ genes?

How does water affect life in India?

Graph the following data. Put distance on the horizontal axis.

$$\begin{matrix} & \text{Distance} & \text{Velocity}\\\text{Object} & \text{(thousand (ly)} & \text{(km/s)}\\\text{Andromeda galaxy} & \text{224} & \text{-10}\\\text{Centaurus A} & \text{2116} & \text{251}\\\text{M66} & \text{3680} & \text{593}\\\text{M49} & \text{6746} & \text{822}\\\text{Fornax A} & \text{9200} & \text{1713}\\\end{matrix}$$

In an effort to determine the location of an operator site for a negatively regulated gene, you have made a series of deletions within the regulatory region. The extent of each deletion is shown by the line underneath the sequence, and the resulting expression from the operon (i = inducible; c = constitutive; - = no expression is also indicated).

. . . G G A T C T T A G C C G G C T A A C A T G A T A A A T A T A A . .

. . C C T A G A A T C G G C C G A T T G T A C T A T T T A T A T T . .

a. What can you conclude from these data about the location of the operator site?

b. Why do you think deletions 2 and 4 show no expression?

Write an argument ether for or against compulsory population control. Support your argument with reasons and evidence form this textbook and form your own experience.

Among the structurally simplest riboswitches are the two so-called purine riboswitches, one of which responds to guanine, and the other to adenine. The accompanying diagram shows a guanine riboswitch. Base-pairing between free guanine and a particular cytosine residue within the aptamer determines the riboswitch conformation.

a. What condition in the cellular environment would favor each of the riboswitch configurations?

b. In B. subtilis, guanine riboswitches are located in 5 different transcription units containing 17 different genes. Based on the diagram and your answer to part (a), what biological processes do you think these 17 genes might be involved in? Explain your reasoning.

In Drosophila subobscura, the presence of a recessive gene called grandchildless $(\mathrm{gs})$ causes the offspring of homozygous females, but not those of homozygous males, to be sterile. Can you offer an explanation as to why females and not males are affected by the mutant gene?

Researchers know that Fru-M controls male sexual behavior in Drosophila because inappropriate Fru-M expression in females causes them to behave like males: Such females display male behaviors that are oriented toward other females. a. Describe a fru mutation that could cause expression of Fru-M in females. b. Describe a gene construct that scientists could generate and insert into Drosophila females that would have the same effect as the mutant you described in (a).

Explain how government regulatory policies influence the economy at the local, state , and federal levels, and create oral presentations of social studies information. Use visual aids as appropriate in your oral presentation explaining how government regulatory policies influence the economy at the local, State, and federal levels. Consider the following questions: Why does the Federal Government regulate the economy? What are some key government regulatory agencies in place today? How do government regulatory polices influence the economy at the local, State , and federal levels?

Scientists have exploited the siRNA pathway to perform a technique called RNA interference a means to knock out the expression of a specific gene. without having to make mutations in it. The idea is to introduce dsRNA corresponding to the target gene into an organism; the dsRNA is then processed into an siRNA that leads to the degradation of the target gene's mRNA. One clever method for delivery of the dsRNA to some organisms (the nematode C. elegans, for example) is to feed them bacteria transformed with a recombinant plasmid that expresses dsRNA. a. Draw a gene construct that, when expressed from a plasmid in bacteria, could be used to knock out the expression of gene X of C. elegans. b. How can you test if gene X expression is obliterated in worms that have eaten the bacteria transformed with a plasmid containing your construct? c. Do you think that only gene X expression will be affected in these worms? Explain.

By searching a human genomic database, you have found a gene that encodes a protein with weak homology to Argonaute, a factor present in complexes that bind to certain miRNAs and mediate the ability of these miRNAs to regulate the stability or translation of target mRNAs (review Figs. 16.25 and 16.26 on p. 563). a. How would you determine which specific miRNAs night be associated with the new protein you discovered? (Think about how you might use a variation of the ChIP-Seq technique described in Fig, 16.17 on p. 556 to explore this question.) b. If a mouse could be obtained that was homozygous for a null mutation of the mouse gene almost identical to the human gene you found, how could you use this mutant mouse to ask what mRNAs might be targeted by the miRNA-RISC complexes containing your Argonaute-like protein?