Under conditions of nutrient starvation, bacteria produce a protein that binds to the $3'$ end of $16$S rRNA. What is the result of this interaction and why is it beneficial to the cell?

List all possible codons present in a ribonucleotide polymer containing U and G in random sequence. Which amino acids are encoded by this RNA?

Wild-type E. coli cells can synthesize all 20 common amino acids, but some mutants, called amino acid auxotrophs, are unable to synthesize a specific amino acid and require its addition to the culture medium for optimal growth. Besides their role in protein synthesis, some amino acids are also precursors for other nitrogenous cell products. Consider the three amino acid auxotrophs that are unable to synthesize glycine, glutamine, and aspartate, respectively. For each mutant, what nitrogenous products other than proteins would the cell fail to synthesize?

What do we call the amino acids that humans can synthesize?

Adult humans synthesize large amounts of ATP in the course of a day, but their body weights do not change significantly. In the same time period, the structures and compositions of their bodies also do not change appreciably. Explain this apparent contradiction.

Explain why a minimum of $32$ tRNAs are required to translate the "standard" genetic code.

It has been proposed that residue A$2486$ is protonated and therefore stabilizes the tetrahedral reaction intermediate. Is this mechanistic embellishment consistent with the observed pH effect? Explain.

Answer the following question to test your understanding of the preceding section:
How do troponin and tropomyosin regulate the interaction between myosin and actin?

The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in $16$S rRNA residues A$1492$ and A$1493$ as are induced by codon-anticodon. Propose an explanation for the antibiotic effect of paromomycin.

EF-Tu binds all aminoacyl-tRNAs with approximately equal affinity so that it can deliver them to the ribosome with the same efficiency. Based on the experimentally determined binding constants for EF-Tu and correctly charged and mischarged aminoacyl-tRNAs (see table), explain how the tRNA-EF-Tu recognition system could prevent the incorporation of the wrong amino acid during translation.

$$\begin{array}{lc} \text { Aminoacyl-tRNA } & \text { Dissociation Constant (nM) } \\ \hline \text { Ala-tRNA }^{\text {Ala }} & 6.2 \\ \hline \text { Gln-tRNA }^{\text {Ala }} & 0.05 \\ \hline \text { Gln-tRNA }^{\text {Gln }} & 4.4 \\ \hline \text { Ala-tRNA }^{\text {Gln }} & 260 \end{array}$$

The sequence of the sense strand of a mammalian gene is

TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATC-

GTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAG-

GCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGAT-

TAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTA-

AGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATA-

AACGATATCGATCGGTTAGGTAAGTCTGAT

Determine the sequences of the mature RNA and the encoded protein. Assume that transcription initiates at a G approximately $25$ bp downstream of the TATAATA sequence, that each $5′$ splice site has the sequence AG/GUAAGU, and that each $3′$ splice site has the sequence CAG/G (where / marks the location of the splice).

A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-$1$ and vir-$2$. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-$1$) and $5$ residues (vir-$2$).

AGATCGGATGCTCAACTATATGTGATTAACAGAGCATGCGGCATAAACT

(a) Identify the DNA sequence that encodes each peptide.

(b) Determine the amino acid sequence of each peptide.

(c) In a mutant viral strain, the T at position $23$ has been replaced with G. Determine the amino acid sequences of the two peptides encoded by the mutant virus.

The flu virus maximizes the use of its limited $(13.5$ kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a different C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.

-GAUUCCUUUCGUCAGUCCGAGA -

One cause of the neurodegenerative disease amyotropic lateral sclerosis (ALS) is the expansion of the repeating hexanucleotide sequence GGGGCC in the noncoding region of a gene. By unknown mechanisms, the repeating sequence is translated to generate neurotoxic peptides. Predict the sequences of the possible repeating dipeptides.