Write the letter of the definition that best matches each term. ____

$$\begin{matrix} \text{Term} & \text{Definition}\\ \text{lysozyme} & \text{ A. An increase in body temperature, which slows or stops pathogens}\\ \text{ } & \text{B. A secretion of the nose and throat that traps pathogens}\\ \text{ } & \text{C. An enzyme found in tears and saliva that breaks down bacterial cell walls}\\ \text{ } & \text{D. Chemicals that increase blood flow to tissues}\\ \text{ } & \text{E. Combination of physical and chemical barriers that defend against pathogens}\\ \text{ } & \text{F. Redness, pain, and swelling at the site of an injury}\\ \text{ } & \text{G. Proteins that fight viral growth}\\ \text{ } & \text{H. The body's most important nonspecific defense}\\ \end{matrix}$$

Brenda needs to get the oil changed in her car, but she hates to wait! Quick Change and Speedy Oil are two garages near Brenda's house. She decides to check an online site that allows customers to comment on the service at different local businesses and record their wat times. Brenda chooses 12 customers at random for each garage. The wait times for each garage are shown.

• Wait Times (minutes)

Quick Change

Speedy Oil

Create a box-and-whisker plot of each data set.

Zillow.com is a real estate Web site that provides free estimates of the market value of homes. A trio of University of Texas at San Antonio professors compared Zillow estimates to actual sale prices of homes and published their results in The Appraisal Journal (Winter 2010). The analysis was based on data collected for 2,045 single-family residential properties in Arlington, Texas, that sold during a recent year. Sale price and Zillow estimated value (in dollars) were measured for each property. Zillow claims that this market has one of its highest accuracy ratings. However, the research revealed that Zillow overestimated the market value by more than 10% for nearly half of the properties. Give a scenario where the 2,045 properties represent a population.

At December 31, 2011, certain accounts included in the property, plant, and equipment section of Reagan Company’s balance sheet had the following balances.

$$\begin{array}{lr} \text{Land} & \$230,000\\ \text{Buildings} & \text{890,000}\\ \text{Leasehold improvements} & \text{660,000}\\ \text{Equipment} & \text{875,000}\\ \end{array}$$

During 2012, the following transactions occurred.

1. Land site number 621 was acquired for $850,000. In addition, to acquire the land Reagan paid a$51,000 commission to a real estate agent. Costs of $35,000 were incurred to clear the land. During the course of clearing the land, timber and gravel were recovered and sold for$13,000.

2. A second tract of land (site number 622) with a building was acquired for $420,000. The closing statement indicated that the land value was$300,000 and the building value was $120,000. Shortly after acquisition, the building was demolished at a cost of$41,000. A new building was constructed for $330,000 plus the following costs.

$$\begin{array}{lr} \text{Excavation fees} & \$38,000\\ \text{Architectural design fees} & \text{11,000}\\ \text{Building permit fee} & \text{2,500}\\ \text{Imputed interest on funds used}\\ \text{$\quad$during construction (stock financing)} & \text{8,500}\\ \end{array}$$

The building was completed and occupied on September 30, 2012.

3. A third tract of land (site number 623) was acquired for $650,000 and was put on the market for resale.

4. During December 2012, costs of$89,000 were incurred to improve leased office space. The related lease will terminate on December 31, 2014, and is not expected to be renewed. (Hint: Leasehold improvements should be handled in the same manner as land improvements.)

5. A group of new machines was purchased under a royalty agreement that provides for payment of royalties based on units of production for the machines. The invoice price of the machines was $87,000, freight costs were$3,300, installation costs were $2,400, and royalty payments for 2012 were$17,500.

Required

(a) Prepare a detailed analysis of the changes in each of the following balance sheet accounts for 2012.

$$\begin{array}{ll} \text{Land} & \text{Leasehold improvements}\\ \text{Buildings} & \text{Equipment} \end{array}$$

$\quad$ Disregard the related accumulated depreciation accounts.

(b) List the items in the situation that were not used to determine the answer to (a) above, and indicate where, or if, these items should be included in Reagan’s financial statements.

$\text{\red{DRAW IT}}$ You are making a genomic library for the aardvark, using a bacterial plasmid as a vector. The green diagram below shows the plasmid, which contains the restriction site for the enzyme used in Figure 20.3. Above the plasmid is a segment of linear aardvark DNA. Diagram your cloning procedure, showing what would happen to these two molecules during each step. Use one color for the aardvark DNA and its bases and another color for those of the plasmid. Label each step and all $5^{\prime}$ and $3^{\prime}$ ends.

$$\begin{array}{lll}5^{\prime} & \text { TCCATGAAT TCTAAAGCGCT TATGAATTCACGGC } & \text { 3' } \\ \text { 3' } & \text { AGGTAC TTAAGATTTCGCGAATACTTAAGTGCCG } & \text { ' TAA TAC }\end{array}$$

Write the letter of the definition that best matches each term. ____

$$\begin{matrix} \text{Term} & \text{Definition}\\ \text{mucus} & \text{ A. An increase in body temperature, which slows or stops pathogens}\\ \text{ } & \text{B. A secretion of the nose and throat that traps pathogens}\\ \text{ } & \text{C. An enzyme found in tears and saliva that breaks down bacterial cell walls}\\ \text{ } & \text{D. Chemicals that increase blood flow to tissues}\\ \text{ } & \text{E. Combination of physical and chemical barriers that defend against pathogens}\\ \text{ } & \text{F. Redness, pain, and swelling at the site of an injury}\\ \text{ } & \text{G. Proteins that fight viral growth}\\ \text{ } & \text{H. The body's most important nonspecific defense}\\ \end{matrix}$$

Brenda needs to get the oil changed in her car, but she hates to wait! Quick Change and Speedy Oil are two garages near Brenda's house. She decides to check an online site that allows customers to comment on the service at different local businesses and record their wat times. Brenda chooses 12 customers at random for each garage. The wait times for each garage are shown.

• Wait Times (minutes)

Quick Change

Speedy Oil

Describe each data distribution and explain its meaning in terms of this problem situation.

In 2003 the Journal of the American Medical Association reported a study examining the possible impact of air pollution caused by the 9/11 attack on New York's World Trade Center on the weight of babies. Researchers found that 8% of 182 babies born to mothers who were exposed to heavy doses of soot and ash on September 11 were classified as having low birth weight. Only 4% of 2300 babies born in another New York City hospital whose mothers had not been near the site of the disaster were similarly classified. Does this indicate a possibility that air pollution might be linked to a significantly higher proportion of low-weight babies? Was this an experiment? Explain.

Write the letter of the definition that best matches each term. ____

$$\begin{matrix} \text{Term} & \text{Definition}\\ \text{inflammatory response} & \text{ A. An increase in body temperature, which slows or stops pathogens}\\ \text{ } & \text{B. A secretion of the nose and throat that traps pathogens}\\ \text{ } & \text{C. An enzyme found in tears and saliva that breaks down bacterial cell walls}\\ \text{ } & \text{D. Chemicals that increase blood flow to tissues}\\ \text{ } & \text{E. Combination of physical and chemical barriers that defend against pathogens}\\ \text{ } & \text{F. Redness, pain, and swelling at the site of an injury}\\ \text{ } & \text{G. Proteins that fight viral growth}\\ \text{ } & \text{H. The body's most important nonspecific defense}\\ \end{matrix}$$

Let $X_1, X_2, X_3, X_4, X_5,$ and $X_6$ denote the numbers of blue, brown, green, orange, red, and yellow M&M candies, respectively, in a sample of size n. Then these $X_{i}^{\prime}s$ have a multinomial distribution. According to the M&M Web site, the color proportions are $p_1 = .24, p_2 = .13, p_3 = .16, p_4 = .20, p_5 = .13,$ and $p_6 = .14$. a. If $n = 12$, what is the probability that there are exactly two M&Ms of each color? b. For $n = 20,$ what is the probability that there are at most five orange candies? [Hint: Think of an orange candy as a success and any other color as a failure.] c. In a sample of 20 M&Ms, what is the probability that the number of candies that are blue, green, or orange is at least 10?

1. The subject’s eyes should be closed. Obtain four coins. Place one coin on the anterior surface of the subject’s forearm, and determine how long the sensation persists for the subject. Duration of the sensation: ________________ sec
2. Repeat the test, placing the coin at a different forearm location. How long does the sensation persist at the second location? ________________ sec
3. After awareness of the sensation has been lost at the second site, stack three more coins atop the first one. Does the pressure sensation return? If so, for how long is the subject aware of the pressure in this instance? ________________ sec
   Are the same receptors being stimulated when the four coins, rather than the one coin, are used?
   Explain how perception of the stimulus intensity has changed._________________________

Write the letter of the definition that best matches each term. ____

$$\begin{matrix} \text{Term} & \text{Definition}\\ \text{histamines} & \text{ A. An increase in body temperature, which slows or stops pathogens}\\ \text{ } & \text{B. A secretion of the nose and throat that traps pathogens}\\ \text{ } & \text{C. An enzyme found in tears and saliva that breaks down bacterial cell walls}\\ \text{ } & \text{D. Chemicals that increase blood flow to tissues}\\ \text{ } & \text{E. Combination of physical and chemical barriers that defend against pathogens}\\ \text{ } & \text{F. Redness, pain, and swelling at the site of an injury}\\ \text{ } & \text{G. Proteins that fight viral growth}\\ \text{ } & \text{H. The body's most important nonspecific defense}\\ \end{matrix}$$

Brenda needs to get the oil changed in her car, but she hates to wait! Quick Change and Speedy Oil are two garages near Brenda's house. She decides to check an online site that allows customers to comment on the service at different local businesses and record their wat times. Brenda chooses 12 customers at random for each garage. The wait times for each garage are shown.

• Wait Times (minutes)

Quick Change

Speedy Oil

Based on the data gathered, which garage should Brenda choose if she is in a hurry?

Whether or not to continue a Mardi Gras Parade through downtown San Luis Obispo, CA, is a hotly debated topic. The parade is popular with students and many residents, but some celebrations have led to complaints and a call to eliminate the parade. The local newspaper conducted online and telephone surveys of its readers and was surprised by the results. The survey web site received more than 400 responses, with more than $60 \%$ favoring continuing the parade, while the telephone response line received more than 120 calls, with more than $90 \%$ favoring banning the parade (San Luis Obispo Tribune, March 3, 2004). What factors may have contributed to these very different results?