Study sets matching "rna biology dna rna dna rna protein"

Study sets
Classes
Users

Study sets matching "rna biology dna rna dna rna protein"

Biology: DNA, RNA, and Proteins
Replication
Transcription
Translation
Transformation
copying process by which a cell duplicates its DNA
process in which part of the nucleotide sequence of DNA is co…
decoding of a mRNA message into a polypeptide chain
process in which one strain of bacteria is changed by a gene…
Replication
copying process by which a cell duplicates its DNA
Transcription
process in which part of the nucleotide sequence of DNA is co…
10 terms
DNA ---> RNA ---> Protein - Biology
DNA
Double Helix
Nucleotide
Base Pairing
A complex molecule containing the genetic information that ma…
"The DNA molecule, resembling a spiral staircase in which the…
A building block of DNA, consisting of a five-carbon sugar co…
principle that bonds in DNA can form only between adenine (A)…
DNA
A complex molecule containing the genetic information that ma…
Double Helix
"The DNA molecule, resembling a spiral staircase in which the…
109 terms
Biology: DNA,RNA and Proteins
Mid-twentieth century scientists
Alfred Hershey and Martha Chase
Viruses
Virus studied in Hershey and Chase
Unsure if proteins or chromosomes were the genetic material o…
Set out to find whether protein or DNA was the genetic materi…
Infect cells and transform them into virus producing factorie…
T2 Bacteriophage
Mid-twentieth century scientists
Unsure if proteins or chromosomes were the genetic material o…
Alfred Hershey and Martha Chase
Set out to find whether protein or DNA was the genetic materi…
15 terms
Biology: DNA, RNA, and Protein
RNA polymerase
messenger RNA (mRNA)
RNA
ribosomal RNA (rRNA)
An enzyme that regulates RNA synthesis
long strands of RNA nucleotides that are formed complementary…
nucleic acid that contains ribose, 4 nitrogenous bases (adeni…
type of RNA that associates with the proteins to form ribosom…
RNA polymerase
An enzyme that regulates RNA synthesis
messenger RNA (mRNA)
long strands of RNA nucleotides that are formed complementary…
10 terms
DNA, RNA, and Protein-Biology
RNA
Messenger RNA
Ribosomal RNA
Transfer RNA
a long linear polymer of nucleotides found in the nucleus but…
RNA molecule that carries copies of instructions for the asse…
Part of the structure of ribosomes.
type of RNA molecule that transfers amino acids to ribosomes…
RNA
a long linear polymer of nucleotides found in the nucleus but…
Messenger RNA
RNA molecule that carries copies of instructions for the asse…
20 terms
DNA/RNA & Protein Synthesis
nucleotide
amino acid
nitrogenous base
hydrogen bond
made of a phosphate group, a 5 carbon sugar, and a nitrogenou…
a compound with an amino group on one end and a carboxyl grou…
adenine, cytosine, guanine, and thymine
a weak attraction between a hydrogen atom and another atom
nucleotide
made of a phosphate group, a 5 carbon sugar, and a nitrogenou…
amino acid
a compound with an amino group on one end and a carboxyl grou…
DNA/RNA Protein Synthesis
DNA
Roselyn Franklin
James Watson/Francis Crick
Nucleotide
Deoxyribonucleic acid is the hereditary material i.
studied the DNA molecule using a technique called X-ray diffr…
developed the double-helix model of the structure of DNA.
made up of a sugar, a phosphate group, and a nitrogenous base.
DNA
Deoxyribonucleic acid is the hereditary material i.
Roselyn Franklin
studied the DNA molecule using a technique called X-ray diffr…
34 terms
DNA/RNA Protein Synthesis
DNA
Roselyn Franklin
James Watson/Francis Crick
Nucleotide
Deoxyribonucleic acid is the hereditary material in humans an…
studied the DNA molecule using a technique called X-ray diffr…
developed the double-helix model of the structure of DNA.
made up of a sugar, a phosphate group, and a nitrogenous base.
DNA
Deoxyribonucleic acid is the hereditary material in humans an…
Roselyn Franklin
studied the DNA molecule using a technique called X-ray diffr…
24 terms
DNA/RNA & Protein Synthesis
nucleotide
amino acid
nitrogenous base
hydrogen bond
made of a phosphate group, a 5 carbon sugar, and a nitrogenou…
a compound with an amino group on one end and a carboxyl grou…
adenine, cytosine, guanine, and thymine
a weak attraction between a hydrogen atom and another atom
nucleotide
made of a phosphate group, a 5 carbon sugar, and a nitrogenou…
amino acid
a compound with an amino group on one end and a carboxyl grou…
Biology: DNA, RNA, and Proteins
DNA Polymerase
DNA Helicase
Base Pair
Complementary Strand
an enzyme that catalyzes the formation of the DNA molecule.
an enzyme that unwinds the DNA double helix during DNA replic…
A = T ; G = C ; made up of nitrogenous bases.
each side of a DNA strand complements the side opposite it, c…
DNA Polymerase
an enzyme that catalyzes the formation of the DNA molecule.
DNA Helicase
an enzyme that unwinds the DNA double helix during DNA replic…
30 terms
DNA, RNA, and Proteins (Biology)
gene
adenine
double helix
DNA
part of DNA that has a specific trait
nitrogen base, always matches with thymine
a "ladder" that spirals upward; shape of DNA
a molecule that contains the entire instructions for making p…
gene
part of DNA that has a specific trait
adenine
nitrogen base, always matches with thymine
DNA, RNA, Protein Synthesis
What sugar is found in DNA?
What sugar is found RNA?
What is the arrangement of DNA propose…
What enzyme unzips DNA before replicat…
Deoxyribose
Ribose
Double Helix
DNA Helicase
What sugar is found in DNA?
Deoxyribose
What sugar is found RNA?
Ribose
Biology DNA/RNA/Protein
What are the building blocks of nuclei…
What two structures constiture the bac…
What is the location of hydrogen bonds…
What are the 4 nitrogenous bases found…
nucleotides
deoxyribose and phosphate
between the nitrogenous bases... between the backbone (phosphod…
ADENINE- THYMINE... GUANINE- CYTOSINE
What are the building blocks of nuclei…
nucleotides
What two structures constiture the bac…
deoxyribose and phosphate
34 terms
Biology DNA, RNA, AND PROTEIN
The letter "DNA" stand of
DNA is composed of smaller subunits kn…
The three parts of a nucleotide are
The four nitrogen bases that are found…
Deoxyribonucleic acid
Nucleotides
Nitrogenous base, Phosphate group, and five carbon sugar
Adenine, Cytosine, Guanie, and Thymine
The letter "DNA" stand of
Deoxyribonucleic acid
DNA is composed of smaller subunits kn…
Nucleotides
33 terms
DNA --> RNA --> Protein
DNA
DNA
RNA
RNA
deoxyribonucleic acid
a long linear polymer found in the nucleus of a cell, formed…
ribonucleic acid
a single-stranded nucleic acid consisting of a phosphate grou…
DNA
deoxyribonucleic acid
DNA
a long linear polymer found in the nucleus of a cell, formed…
Biology DNA, RNA, and Protein
DNA and RNA are polymers called_, and…
What are the three parts of a nucleoti…
If the DNA double helix were a twisted…
What type of bonds hold together the s…
nucleic acids, nucleotides
sugars, phosphate group, nitrogen base
alternating sugar and phosphate
covalent
DNA and RNA are polymers called_, and…
nucleic acids, nucleotides
What are the three parts of a nucleoti…
sugars, phosphate group, nitrogen base
34 terms
DNA/RNA Protein Synthesis
DNA
Roselyn Franklin
James Watson/Francis Crick
Nucleotide
Deoxyribonucleic acid is the hereditary material in humans an…
studied the DNA molecule using a technique called X-ray diffr…
developed the double-helix model of the structure of DNA.
made up of a sugar, a phosphate group, and a nitrogenous base.
DNA
Deoxyribonucleic acid is the hereditary material in humans an…
Roselyn Franklin
studied the DNA molecule using a technique called X-ray diffr…
Biology: DNA, RNA, and Protein
DNA is an example of what macromolecul…
What process copies the DNA into a com…
What site in the cell would you find p…
By the end of transcription and transl…
Nucleic acid is the macromolecule and the monomer is nucleotide
Transcription
Ribosomes
Protein
DNA is an example of what macromolecul…
Nucleic acid is the macromolecule and the monomer is nucleotide
What process copies the DNA into a com…
Transcription
Biology DNA, RNA, Proteins
replication
uracil
DNA polymerase
nucleosomes
making a copy of DNA is called
which nitrogen base isn't used during replication
the enzyme that adds the complementary nucleotides and spell…
the beadlike bundles that form when DNA wraps up
replication
making a copy of DNA is called
uracil
which nitrogen base isn't used during replication
8 terms
DNA, RNA, and protein synthesis
The sugar in DNA is
What are the three components of a nuc…
Is this structure DNA or RNA?
What process is shown in the diagram?
deoxyribose
sugar, phosphate, and nitrogenous base
DNA
Transcription.
The sugar in DNA is
deoxyribose
What are the three components of a nuc…
sugar, phosphate, and nitrogenous base
24 terms
Biology DNA/RNA & proteins
Ribomsomes are made out of?
According to chargaffs rules which nuc…
DNA replication results in two DNA mol…
Which types of RNA is/are involved in…
RNA & protiens
Thymine
Each with one new strand & one original strand
All 3 kinds of RNA
Ribomsomes are made out of?
RNA & protiens
According to chargaffs rules which nuc…
Thymine
Biology - DNA, RNA, and Proteins
rRNA - function
mRNA - function
tRNA - function
tRNA (2 parts)
The Ribosomal RNA binds to the mRNA
The Messenger RNA carries genetic information from the DNA to…
The Transfer DNA carries amino acids to the ribosomes
Amino acids and anticodon
rRNA - function
The Ribosomal RNA binds to the mRNA
mRNA - function
The Messenger RNA carries genetic information from the DNA to…
17 terms
Biology: DNA, RNA, and Proteins
the "blueprint" from which all living…
he showed that traits were passes from…
the instructions for inherited traits…
deoxyribonucleic acid
What is DNA?
Who was Gregor Mendel?
Genes
What does DNA stand for?
the "blueprint" from which all living…
What is DNA?
he showed that traits were passes from…
Who was Gregor Mendel?
14 terms
Biology DNA, RNA, and Proteins
thomas hunt morgan
fredrick griffith
double helix
nucleotides
used the white eyed fly to show chromosomes where the heart o…
discovered the 2 types of bacteria: S and R. s carries pneumo…
the "spiral staircase" form of DNA
carbon based subunits that make up DNA
thomas hunt morgan
used the white eyed fly to show chromosomes where the heart o…
fredrick griffith
discovered the 2 types of bacteria: S and R. s carries pneumo…
38 terms
Biology DNA, RNA and Proteins
Identify the scientist responsible for…
If your DNA strand contains 40% guanin…
How many different mRNA codons are there
How many different amino acids are there
Franklin
10%
64
20
Identify the scientist responsible for…
Franklin
If your DNA strand contains 40% guanin…
10%
Biology DNA, RNA, and Proteins
The three bases on the tRNA molecule t…
Which nucleotide is always paired with…
Ribosomes are made of
DNA replication results in two DNA mol…
Anticon
(T)hymine
RNA and Proteins
one new strand and one original strand
The three bases on the tRNA molecule t…
Anticon
Which nucleotide is always paired with…
(T)hymine
24 terms
DNA, RNA, and Protein Synthesis
Complementary Base Pair
Chromosome
Gene
Genome
the nucleotide bases in one strand of DNA or RNA that are pai…
Any of several threadlike structure within the nucleus that c…
A sequence of DNA that codes for a single protein and therefo…
The complete genetic material of an organism.
Complementary Base Pair
the nucleotide bases in one strand of DNA or RNA that are pai…
Chromosome
Any of several threadlike structure within the nucleus that c…
37 terms
DNA, RNA, Protein Synthesis
What sugar is found in DNA?
What sugar is found RNA?
What is the arrangement of DNA propose…
What enzyme unzips DNA before replicat…
Deoxyribose
Ribose
Double Helix
DNA Helicase
What sugar is found in DNA?
Deoxyribose
What sugar is found RNA?
Ribose
24 terms
Biology DNA-RNA-Proteins Vocab
1. DNA ... (deoxyribonucleic acid)
gene
chromosomes
genome
master copy of an organism's informational code that contains…
segment of DNA that controls protein production and the cell…
cell structures that carry the genetic material that is copie…
the complete set of genes or genetic material present in a ce…
1. DNA ... (deoxyribonucleic acid)
master copy of an organism's informational code that contains…
gene
segment of DNA that controls protein production and the cell…
17 terms
Biology: DNA, RNA, and Proteins
What is DNA?
Who was Gregor Mendel?
Genes
What does DNA stand for?
the "blueprint" from which all living things are made
he showed that traits were passes from parents to offspring
the instructions for inherited traits located on chromosomes
deoxyribonucleic acid
What is DNA?
the "blueprint" from which all living things are made
Who was Gregor Mendel?
he showed that traits were passes from parents to offspring
DNA and RNA; RNA and protein synthesis
genes
messenger RNA
ribosomal RNA
transfer RNA
a sequence of DNA that encodes for the production of a protein
RNA that carries copies of instructions for assembling amino…
RNA that makes up ribosomes and read the mRNA to assemble pro…
RNA fetch the correct amino acid and attach them to growing p…
genes
a sequence of DNA that encodes for the production of a protein
messenger RNA
RNA that carries copies of instructions for assembling amino…
DNA, RNA, and Protein Synthesis
Complementary Base Pair
Chromosome
Gene
Genome
the nucleotide bases in one strand of DNA or RNA that are pai…
Any of several threadlike structure within the nucleus that c…
A sequence of DNA that codes for a single protein and therefo…
The complete genetic material of an organism.
Complementary Base Pair
the nucleotide bases in one strand of DNA or RNA that are pai…
Chromosome
Any of several threadlike structure within the nucleus that c…
DNA/RNA Protein Synthesis
DNA
Roselyn Franklin
James Watson/Francis Crick
Nucleotide
Deoxyribonucleic acid is the hereditary material in humans an…
studied the DNA molecule using a technique called X-ray diffr…
developed the double-helix model of the structure of DNA.
made up of a 5-carbon sugar, a phosphate group, and a nitroge…
DNA
Deoxyribonucleic acid is the hereditary material in humans an…
Roselyn Franklin
studied the DNA molecule using a technique called X-ray diffr…
40 terms
DNA, RNA, Protein
Shape of the DNA?
Scientists credited with establishing…
Molecules of DNA are composed of long…
What are pyrimidines?
Double Helix
Watson and Crick
Nucleotides
thymine and cytosine
Shape of the DNA?
Double Helix
Scientists credited with establishing…
Watson and Crick
Biology DNA, RNA, and Proteins
RNA
Messenger RNA
Ribosomal RNA
Transfer RNA
a nucleic acid present in all living cells
the form of RNA in which genetic information transcribed from…
the cell's essential protein factory
consisting of folded molecules that transport amino acids fro…
RNA
a nucleic acid present in all living cells
Messenger RNA
the form of RNA in which genetic information transcribed from…
25 terms
DNA/RNA Protein Synthesis
DNA
Nucleotide
Chargaff's Rule
Double Helix
Deoxyribonucleic acid is the hereditary material in humans an…
made up of a 5-carbon sugar, a phosphate group, and a nitroge…
Adensine=Thymine and Cytosine=Guanine
The shape of DNA consists of two strands of polynucleotide ch…
DNA
Deoxyribonucleic acid is the hereditary material in humans an…
Nucleotide
made up of a 5-carbon sugar, a phosphate group, and a nitroge…
DNA, RNA, and Protein
nucleotide
deoxyribose
nitrogenous base
purines
in a nucleic-acid chain, a subunit that consists of a sugar,…
a five-carbon sugar that is a component of DNA molecules
Contains nitrogen and carbon atoms and is a base; adenine, gu…
Nitrogen bases that have a double ring of carbon and nitrogen…
nucleotide
in a nucleic-acid chain, a subunit that consists of a sugar,…
deoxyribose
a five-carbon sugar that is a component of DNA molecules
34 terms
DNA, RNA, Protein Synthesis
What sugar is found in DNA?
What sugar is found RNA?
What is the arrangement of DNA propose…
What enzyme unzips DNA before replicat…
Deoxyribose
Ribose
Double Helix
DNA Helicase
What sugar is found in DNA?
Deoxyribose
What sugar is found RNA?
Ribose
DNA, RNA, and Protein Synthesis
Deoxyribonucleic Acid (DNA)
Double Helix
Nucleotide
Deoxyribose
The entire collection of recipes found in every cell .
The twisted ladder shape found in DNA.
The building block of DNA & RNA (made of a sugar, a phosphate…
The sugar found in every DNA nucleotide
Deoxyribonucleic Acid (DNA)
The entire collection of recipes found in every cell .
Double Helix
The twisted ladder shape found in DNA.
20 terms
DNA, RNA and Protein Synthesis
Amino Acid
Anticodon
Base pairing
Codon
Compound with an amino group (NH2) on one end and a carboxyl…
Group of three bases on a tRNA molecule that are complementar…
Principle that bonds in DNA can form only between adenine and…
Three-nucleotide sequence on mRNA that codes for a single ami…
Amino Acid
Compound with an amino group (NH2) on one end and a carboxyl…
Anticodon
Group of three bases on a tRNA molecule that are complementar…
Biology- DNA, RNA, Protein Synthesis
what does dna stand for
what is dna's primary function
what is the sugar in dna
what are the repeating subunits called…
deoxyribonucleic acid
genetic info to build an organism
deoxyribose
nucleotides
what does dna stand for
deoxyribonucleic acid
what is dna's primary function
genetic info to build an organism
26 terms
DNA-RNA-Protein Synthesis
DNA
RNA
Nucleotide
Deoxyribose
Deoxyribonucleic Acid
Ribonucleic Acid
Monomer of nucleic acid : made of 1) sugar 2) phosphate group…
Sugar in a molecule of DNA
DNA
Deoxyribonucleic Acid
RNA
Ribonucleic Acid
DNA/RNA and protein synthesis
DNA
Deoxyribose
Double Helix
Nucleotides
Deoxyribonulcleic acid
Sugar in DNA
Shape and structure of DNA
Building block of DNA and RNA. Made of a phosphate group, sug…
DNA
Deoxyribonulcleic acid
Deoxyribose
Sugar in DNA
54 terms
DNA, RNA, and Protein Synthesis
What is the primary function of DNA in…
What is the process of DNA duplicating…
When does DNA duplicate itself?
What is the spiral structure of the tw…
to store information that tells the cells which proteins to m…
Replication
Right before the cell divides
double helix
What is the primary function of DNA in…
to store information that tells the cells which proteins to m…
What is the process of DNA duplicating…
Replication
30 terms
Biology: DNA, RNA, and Protein Synthesis
adenine
Chargaff's rule
base pairing rule
cytosine
double-ring nitrogenous base molecule in DNA and RNA, complem…
adenine = thymine... cytosine = guanine
A = T, C = G
single-ring nitrogenous base molecule in DNA and RNA, complem…
adenine
double-ring nitrogenous base molecule in DNA and RNA, complem…
Chargaff's rule
adenine = thymine... cytosine = guanine
DNA, RNA and Protein Synthesis
nucleotide
deoxyribose
adenine
guanine
consists of a phosphate group, a sugar molecule, and a nitrog…
a five carbon sugar found in DNA
a nitrogenous base that is a purine and forms two hydrogen bo…
a nitrogenous base that is a purine and forms three hydrogen…
nucleotide
consists of a phosphate group, a sugar molecule, and a nitrog…
deoxyribose
a five carbon sugar found in DNA
22 terms
Biology DNA/RNA protein synthesis
The steps of a spiral staircase would…
Due to base pairing in dna, the amount…
What is the mRNA sequence for the foll…
Which pair of scientists discovered th…
nitrogen base pairs
adenine molecules are about equal to thymine molecules
UGGUAUUUUCACCAAGAGCGC
Watson and Crick
The steps of a spiral staircase would…
nitrogen base pairs
Due to base pairing in dna, the amount…
adenine molecules are about equal to thymine molecules
29 terms
6 - DNA/RNA Protein Synthesis
DNA
Roselyn Franklin
James Watson/Francis Crick
Nucleotide
Deoxyribonucleic acid is the hereditary material in humans an…
studied the DNA molecule using a technique called X-ray diffr…
developed the double-helix model of the structure of DNA.
made up of a sugar, a phosphate group, and a nitrogenous base.
DNA
Deoxyribonucleic acid is the hereditary material in humans an…
Roselyn Franklin
studied the DNA molecule using a technique called X-ray diffr…
15 terms
DNA & RNA and Protein Synthesis
DNA
Double Helix
RNA
Types of RNA
Deoxyribonucleic Acid. The double helix (spiral staircase) sh…
A spiral staircase shape that represents the structure of DNA.
Ribonucleic Acid. The single stranded molecule that copies a…
mRNA: Messenger RNA. This molecule carries the instructions f…
DNA
Deoxyribonucleic Acid. The double helix (spiral staircase) sh…
Double Helix
A spiral staircase shape that represents the structure of DNA.
1 of 10